sORF ID: elkon_2015:572138 Basic information sORF ID: elkon_2015:572138 Gene location: 17 chr: 17 pos: 77141024 -77141101 Strand: sense Transcript length: 75bp (25aa) Biotype: protein_coding Annotation: 5UTR Predicted mass: 2,715.40Da Downstream gene distance: not available Upstream gene distance: not available Start codon: GTG Exon overlap: 0.0% Overlap with protein coding segments No Spliced: Not spliced Currently represented RPF-lengths: RPFs of all lengthsCurrently represented frames: all frames ALL RPF RPF 27 RPF 28 RPF 29 RPF 30 RPF 31 RPF 32 ALL frames in-frame +1 frame +2 frame RNA sequence: GTGGAACCGAGACTGCCCCGCGGAGCCGCCGGTATGAGCGCCCCTCGCCACCCCGTGTCCCAGGCCCGGCCTTTCTGA Predicted AA-sequence: MEPRLPRGAAGMSAPRHPVSQARPF* This Micropeptide was also identified in: sORF ID species cell line gawron_2016:176709 human gawron_2016 gonzalez_2014:459104 human gonzalez_2014 jakobsson_2017:421499 human jakobsson_2017 jan_2014:145049 human jan_2014 liu_HEK_2013:348554 human liu_HEK_2013 liu_Hela_2013:169379 human liu_Hela_2013 loayza_puch_2013:656327 human loayza_puch_2013 park_2016:735785 human park_2016 rubio_2014:883360 human rubio_2014 tirosh_2015:656452 human tirosh_2015 wiita_2013:341527 human wiita_2013 xu_2016:609193 human xu_2016 Cross-species sORF BLASTp Identifications No significant Cross Species sORF BLASTp matches found. Variation analysis No variational information available for elkon_2015:572138. BLASTp analysis No significant BLASTp matches found for elkon_2015:572138. PRIDE ReSpin No PRIDE-ReSpin identifications Experiment information Cell line: elkon_2015 Species: human Ensembl version: 92 Used mapper: STAR Only unique maps: N Adapter sequence: TGGAATTCTCGGGTGCCAAGG Total CHX reads: 252426269 Total CHX genomic reads: 129803198 Total CHX reads mapped to rRNA: 111507229 Total CHX reads mapped to CDS: 54721802 Total HARR/LTM reads: Total HARR/LTM reads mapped to rRNA: Total HARR/LTM reads mapped to CDS: Return to previous page