FastQCFastQC Report
Tue 6 Dec 2016
fastq1_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq1_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences22390703
Sequences flagged as poor quality0
Sequence length26-75
%GC51

[OK]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGTACACGGAGTCGACCCGCAACGCGA13232375.9097608502957675No Hit
ATGTACACGGAGTCGAGCTCAACCCGCAACGCG799570.35709910492761215No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CTCGTAT12450.077.73743449
TATCTCG12750.073.3429646
ACCGCGA16750.068.18535628
TCTCGTA15050.062.70813448
ATATCTC20900.044.39756845
ATGCCGT22200.043.6685754
ATCTCGT23900.039.31927547
CGGTAGC4403.6876372E-837.16477266
TATGCCG31600.036.651853
CGCCAAT26650.034.81954640
AGTCACG27100.034.61235435
GCTTGAA33050.032.1607466
CGTATGC42250.030.35909751
CTTGAAA34950.029.3963767
CGTTCGC21700.029.02088225
ATGTACA1960950.026.932841
TGTACAC2011050.026.412652
GTACACG2021650.026.2291343
AACGCGA1844850.026.0955828
TACACGG2027400.025.9954194