FastQCFastQC Report
Fri 7 Jul 2017
fastq1_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq1_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences100518244
Sequences flagged as poor quality0
Sequence length50
%GC52

[OK]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGCGGTCCGGATCGTATGGGTTATCAATTTGGAATTCTCGGGTGCCAAGG4378530.43559555218652646Illumina Small RNA Adapter 2 (100% over 21bp)
ACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTG4375820.43532594938685953RNA PCR Primer, Index 2 (97% over 35bp)
GAATTCCACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCA4277060.4255008672853457RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTGACCAATCTCGTATGC3770130.37506922623916905RNA PCR Primer, Index 4 (100% over 50bp)
CACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACT2521530.25085296953655495RNA PCR Primer, Index 3 (100% over 34bp)
TCTATTAATTAATCTGACGTGATATTAGTGGAATTCTCGGGTGCCAAGGA1658100.16495512993641234RNA PCR Primer, Index 1 (100% over 22bp)
ATAGGTCCGGAGTCGGTGGGTTATCTGAATGGAATTCTCGGGTGCCAAGG1297440.1290750761622935Illumina Small RNA Adapter 2 (100% over 21bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCGGTCC681300.040.3901062
TGCGGTC696150.039.681141
TAATTAA264000.039.266276
TATTAGT259900.038.9142123
TTAATTA269450.038.518585
TCTATTA269350.038.4623571
GGGTTAT974650.038.3875318
ATAGGTC187150.038.1520461
TAGGTCC190050.038.0959322
CTATTAA269800.037.9540062
GTCGCGC102500.037.6268723
GTATGGG742650.037.62195214
AATTCCA2004500.037.486482
TATGGGT752600.037.2414315
TTAATCT285650.036.8229529
ATATTAG275350.036.6923422
CGGATCG759750.036.600198
TATTAAT280800.036.459233
GGTTATC1028300.036.10658319
TATCAAT723250.035.8569622