FastQCFastQC Report
Mon 3 Apr 2017
fastq1_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq1_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences33601552
Sequences flagged as poor quality0
Sequence length50
%GC50

[OK]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGTACACGGAGTCGACCCAACGCGACTGTAGGCACCATCAATAGATCGG5032431.4976778453566668No Hit
ATGTACACGGAGTCGAGCTCAACCCGCAACGCGACTGTAGGCACCATCAA2677500.7968381936643879No Hit
CTGTAGGCACCATCAATAGATCGGAAGAGCACACGTCTGAACTCCAGTCA2185930.6505443558083269Illumina Multiplexing PCR Primer 2.01 (100% over 33bp)
ACGATTAAAGTCCTACGTGATCTGAGTCTGTAGGCACCATCAATAGATCG1255780.3737267850008833No Hit
ACGATTAAAGTCCTACGTGATCTGAGTTCTGTAGGCACCATCAATAGATC861170.25628875713836075No Hit
TCGATTAAAGTCCTACGTGATCTGAGTCTGTAGGCACCATCAATAGATCG830140.24705406464558544No Hit
ACCTCTAGCATTACAAGTATTAGAGGCCTGTAGGCACCATCAATAGATCG702920.20919271824110983No Hit
AAAAGGTTTGGTCCTGGCCTTATAATCTGTAGGCACCATCAATAGATCGG497210.14797233175419994No Hit
ATGTCCACGGAGTCGACCCAACGCGACTGTAGGCACCATCAATAGATCGG457900.13627346736841203No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TCGATTA197850.042.9136051
TTTTCGC249450.042.13441
ATGTACA1332200.040.1217081
TCGTTTT195950.039.643271
GTACACG1347950.039.424983
TGTACAC1359900.039.226242
TTGACGT69150.039.0226331
AAATAGC139550.038.9405631
GCGATTA26800.038.914881
CCGATTA40000.038.6428831
TCTCCCG245150.038.4848981
TAGCTTA144200.037.9946484
GTCGACC982350.037.56284712
ATAGCTT146200.037.5500953
AGTCGAC992050.037.442711
CGACCCA973200.037.4101214
TACACGG1418750.037.4063454
TCGACCC981950.037.26841713
CCCAACG974950.036.97192817
GCGCAAT132000.036.8648266