FastQCFastQC Report
Mon 15 May 2017
fastq1_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq1_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences602056482
Sequences flagged as poor quality0
Sequence length44
%GC66

[OK]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AGCCCGCGGACGGTGTGAGGCCGGTGTCGGCCCCCCTGTAGGCA582045229.667618195330716No Hit
AGCCCGCGGACGGTGTGAGGCCGGTGTCGGCCCCCTGTAGGCAC282156554.68654617026447No Hit
AGCCCGCGGACGGTGTGAGGCCGGTGTCGGCCCCTCTGTAGGCA223203203.7073465143757063No Hit
GCCCGCGGACGGTGTGAGGCCGGTGTCGGCCCCCCTGTAGGCAC149778532.487782035041689No Hit
GGAGCGCCGCGACCGGCTCCGGTTCGGCTTGGACTGTAGGCACC75694941.2572730676122843No Hit
GGACGGTGTGAGGCCGGTGTCGGCCCCCCTGTAGGCACCATCAA69250771.1502370968576334No Hit
GCCCGCGGACGGTGTGAGGCCGGTGTCGGCCCCCTGTAGGCACC64614161.0732242228396105No Hit
GGAGCGCCGCGACCGGCTCCGGTTCGGCTTGGAACTGTAGGCAC51525020.8558170460823973No Hit
AGCCCGCGGACGGTGTGAGGCCGGTGTCGGCCCCTGTAGGCACC51243430.8511399101587948No Hit
GCCCGCGGACGGTGTGAGGCCGGTGTCGGCCCCTCTGTAGGCAC46193160.7672562522132267No Hit
GAGCGCCGCGACCGGCTCCGGTTCGGCTTGGAAGCTGTAGGCAC41909180.6961004698559162No Hit
CTCCGGGGCCGCGGGTGAGTGTCCTCCGCGCCCCTGTAGGCACC40727510.6764732415919741No Hit
GGAATGAGTGCATCCCAAACCCATGGGCGACTGTAGGCACCATC38370730.6373277449407146No Hit
CGACCCACGTTCGGGCGCCCGAGGTCCGCGGCGACTGTAGGCAC34678460.5760001102355045No Hit
AGCCCGCGGACGGTGTGAGGCCGGTGTCGGCCCCCGCTGTAGGC30702750.5099646115927043No Hit
CTCCGGGGCCGCGGGTGAGTGTCCTCCGCGCCCTCTGTAGGCAC28727360.4771539026466291No Hit
GGGGGCCGCCCCTGCTTCTGGCGTCAAGCGCCCCGGCTGTAGGC27511250.4569546350304056No Hit
GGACGGTGTGAGGCCGGTGTCGGCCCCCTGTAGGCACCATCAAT26921810.4471641914819547No Hit
AGATCTCATATCGTCGCTCGTCATGCGTGTATGCGTCTGCATAC23170220.38485126716067813No Hit
GGAGCGCCGCGACCGGCTCCGGTTCGGCTTGGAAGCTGTAGGCA23127220.3841370484571911No Hit
CACGTCACGTGTACGTAGTACGTACGCATACACGCATGTACGTA22291310.3702528029587762No Hit
GTGCAGTGCGCACATATCACATGCTATGCGTGTATGACAGTCGT22015780.3656763220431534No Hit
TCTAGAGTACAGTGACGAGTGACGATACACGCATACGACTGACG21634330.35934053775373187No Hit
TGCCGAGGGCGAGGGACCTGTGGCGTACGGAGGCTGTAGGCACC21176750.35174025416439253No Hit
GCGGACGGTGTGAGGCCGGTGTCGGCCCCCCTGTAGGCACCATC21122690.3508423317664737No Hit
GGCGGCGTCCGGTGAGCTCTCGTCGGCCCTTGCTGTAGGCACCA20360550.3381833865879713No Hit
CTCCGGGGCCGCGGGTGAGTGTCCTCCGCGCCCTGTAGGCACCA20315640.33743744328625963No Hit
GCTTGCTCTCCGGGGCCGCGGGTGAGTGTCCTCCGCTGTAGGCA19115640.3175057585377845No Hit
CGACCTCAGCTCAGACGAGAAGACCCGCTGAACTGTAGGCACCA18898490.313898954085175No Hit
TGGCGGCGTCCGGTGAGCTCTCGTCGGCCCTTGCTGTAGGCACC18601540.30896669259679194No Hit
GCCCGCGGACGGTGTGAGGCCGGGGTCGGCCCCCCTGTAGGCAC14627000.2429506273466216No Hit
TGCTGCGATCCATTGAAAGTCAGCCCTCCTGTAGGCACCATCAA13869530.2303692496412654No Hit
CGACCTCAGCTCAGACGAGAAGACCCGCTGACTGTAGGCACCAT13053200.21681022279899645No Hit
GCGGACGGTGTGAGGCCGGTGTCGGCCCCCTGTAGGCACCATCA12815710.21286557628990033No Hit
GGGGGCCGCCCCTGCTTCTGGCGTCAAGCGCCCCGCTGTAGGCA12771410.2121297649279358No Hit
TAGCCCGCGGACGGTGTGAGGCCGGTGTCGGCCCCCCTGTAGGC12681790.21064120027197047No Hit
GAAGGCCGAAGTGGAGAAGGGTTCCATGTGCTGTAGGCACCATC12529520.2081120355747619No Hit
GAGCGCCGCGACCGGCTCCGGTTCGGCTTGGAAGGCTGTAGGCA12344520.20503923417603864No Hit
CGAGGGCGAGGGACCTGTGGCGTACGGAGGCTGTAGGCACCATC11612070.19287343209768815No Hit
CGACCCACGTTCGGGCGCCCGAGGTCCGCGGCGCTGTAGGCACC11542540.1917185570638869No Hit
GCTTGCTCTCCGGGGCCGCGGGTGAGTGTCCTCCCTGTAGGCAC10900030.1810466347574346No Hit
GCCCGCGGACGGTGTGAGGCCGGTGTCGGCCCCTGTAGGCACCA10555800.1753290648899616No Hit
GCTGCGATCCATTGAAAGTCAGCCCTCGATCCAACTGTAGGCAC10394900.17265655815993688No Hit
CTCCGGGGCCGCGGGTGAGTGTCCTCCGCGCCTGTAGGCACCAT9714590.1613567877839076No Hit
GCGGACGGTGTGAGGCCGGTGTCGGCCCCTCTGTAGGCACCATC9562090.15882380284712225No Hit
TGGAATGAGTGCATCCCAAACCCATGGGCGACTGTAGGCACCAT8905850.1479238288476728No Hit
GCCGAGGGCGAGGGACCTGTGGCGTACGGAGGCTGTAGGCACCA8659100.14382537617126762No Hit
CGCGGACGGTGTGAGGCCGGTGTCGGCCCCCCTGTAGGCACCAT8431750.14004915239829607No Hit
GCCCGCGGACGGTGTGAGGCCGGGGTCGGCCCCCTGTAGGCACC8369810.13902034527052895No Hit
GCTGCGATCCATTGAAAGTCAGCCCTCGATCCCTGTAGGCACCA8216920.13648088253620033No Hit
AGCCCGCGGACGGTGTGAGGCCGGTGTCGGCCCTGTAGGCACCA7957060.13216467620391803No Hit
CGCTTGCTCTCCGGGGCCGCGGGTGAGTGTCCTCCGCTGTAGGC7474070.12414233919002969No Hit
CTTCCAGTGACGCACCGCATGTTTGTGGGGACTGTAGGCACCAT7347390.12203821767008231No Hit
GCTGCGATCCATTGAAAGTCAGCCCTCGATCCACTGTAGGCACC7320950.12159905621612425No Hit
CCCCGAGAGAGGGGCCCGCGCCCTGGAAAGCGCCGCCTGTAGGC7035810.11686295572514076No Hit
GCTTGCTCTCCGGGGCCGCGGGTGAGTGTCCTCCGCCTGTAGGC6833370.113500480508073No Hit
GAGGGCGAGGGACCTGTGGCGTACGGAGGCTGTAGGCACCATCA6157980.10228243003951247No Hit
GCCCGCGGACGGTGTGAGGCCGGGGTCGGCCCCTCTGTAGGCAC6111400.10150874847652583No Hit
GGCCCCCGGCGCGGAGAGCCATTCGTGACAGGAACTGTAGGCAC6102140.10135494230921677No Hit
CCATCTAAGGCTAAATACCGGCACGAGACCGACTGTAGGCACCA6033080.100207873851942No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTAGTA2279150.037.80027414
TAGTACG2285950.037.70229316
GTAGTAC2287900.037.68283515
ACGTAGT2287400.037.6756413
ACGTACG2287400.037.63870220
TACGCAT2288850.037.54437323
ATCGTCG2413200.037.5251310
AGTACGT2302450.037.4562417
CTATGCG2274650.037.4161324
ATATCGT2428700.037.375198
CGACCCA5466000.037.2942851
TAGAGTA2308000.037.282893
TATCGTC2431900.037.2615749
GCATACG2308150.037.25945731
ATACGAC2308500.037.25919733
CTCGTCA2430850.037.25149517
CGTACGC2317700.037.2456321
TACGTAG2312600.037.22073412
TCTCATA2437850.037.2154
CATACGA2311700.037.21186432