FastQCFastQC Report
Mon 3 Apr 2017
fastq1_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq1_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences136132827
Sequences flagged as poor quality0
Sequence length52
%GC58

[OK]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
CGCCTTGGCCGTACAGCAGTGAGTCTCGTATGCCGTCTTCTGCTTGAAAAAA57743394.241694767713889TruSeq Adapter, Index 15 (96% over 28bp)
CGCCTTGGCCGTACAGCAGGTGAGCTCGTATGCCGTCTTCTGCTTGAAAAAA38951372.861276802839039Illumina PCR Primer Index 5 (96% over 27bp)
ACCTCGGCCGGCGAGCGCGCCGGCCTTCACCTTCCGCCTTGGCCGTACAGCA17381881.2768323690214705No Hit
GCCCGGATAGCTCAGTCGGTAGAGCATCAGACTCGCCTTGGCCGTACAGCAG14806261.0876333303502175No Hit
CGCCTTGGCCGTACAGCAGATCTGCTCGTATGCCGTCTTCTGCTTGAAAAAA14719561.0812645505407745TruSeq Adapter, Index 20 (96% over 25bp)
GCCCGGATAGCTCAGTCGGTAGAGCATCAGACTTCGCCTTGGCCGTACAGCA12619130.9269718610926958No Hit
GCCCGGATAGCTCAGTCGGTAGAGCATCAGACCGCCTTGGCCGTACAGCAGA11611240.8529346121637509No Hit
ACGCGGGAGACCGGGGTTCGATTCCCCGACGGGCGCCTTGGCCGTACAGCAG11501790.8448946704089235No Hit
GCCCGGATAGCTCAGTCGGTAGAGCATCAGACGCCTTGGCCGTACAGCAGAT10910300.801445194405608No Hit
ACGCGGGAGACCGGGGTTCGATTCCCCGACGGGGCGCCTTGGCCGTACAGCA9203830.6760918878148325No Hit
CGCCTTGGCCGTACAGCAGATACCTATCGTATGCCGTCTTCTGCTTGAAAAA6556860.48165164453684634TruSeq Adapter, Index 16 (96% over 25bp)
GAATACAAGCTTGGGCTGCAGGTCGACCCGTGCGGACGCCTTGGCCGTACAG5463750.40135433314699326No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCGCCTTGGCCGTACAGCAG5010690.36807360211508716No Hit
AACCCCCGGGACGGGGACCGGCGGGCCACGGGCCCGGCTCCGCCTTGGCCGT4190310.3078104004995063No Hit
CGCCTTGGCCGTACAGCAGCTCTGGCTCGTATGCCGTCTTCTGCTTGAAAAA4152340.3050212128482427Illumina Single End Adapter 1 (95% over 24bp)
ACCGGGGCCCGCGCGGCCAACCCCCGGGACGGGGACCGCCTTGGCCGTACAG3677100.2701111907416717No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCCGCCTTGGCCGTACAGCA3615830.2656104394276628No Hit
TGCACGAGGCCCCGGGTTCAATCCCCGGCACCTCCACCACGCCTTGGCCGTA3583770.26325538659385955No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACCGCCTTGGCCGTACAGCAGA3536240.25976394363719485No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCCCGCCTTGGCCGTACAGC3354100.24638436400060948No Hit
GCCCGGATAGCTCAGTCGGTAGAGCATCAGACCGCCTTGGCCGTACAGCAGC3062070.2249325212353079No Hit
GCCCGGATAGCTCAGTCGGTAGAGCATCAGACTTTCGCCTTGGCCGTACAGC3031090.22265680268286794No Hit
GAGAAATAGAGCCACCTTACAAATAAGCGCTCTCCGCCTTGGCCGTACAGCA2867690.21065381974327174No Hit
GCCCGGATAGCTCAGTCGGTAGAGCATCAGACGCCTTGGCCGTACAGCAGCT2754700.2023538378439757No Hit
GGACGGCGCCGGACGCGCACGCCCCGCCGGGCCCCCCGCCGCCTTGGCCGTA2664220.19570738804976112No Hit
GAATACAAGCTTGGGCTGCAGGTCGACCCGTGCCGCCTTGGCCGTACAGCAG2550850.1873794922366521No Hit
CGCCTTGGCCGTACAGCAGTTCAGCATCGTATGCCGTCTTCTGCTTGAAAAA2483270.18241522303801125Illumina Single End Adapter 1 (95% over 22bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGGGACTCGCCTTGGCCGTACAGCAG2472100.1815947008872445No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACGCCTTGGCCGTACAGCAGAT2445050.17960767096976543No Hit
CGCCTTGGCCGTACAGCAGACGCCAATCGTATGCCGTCTTCTGCTTGAAAAA2293360.16846487732161766Illumina Single End Adapter 1 (95% over 22bp)
CGCGGGAGACCGGGGTTCGATTCCCCGACGGGGCGCCTTGGCCGTACAGCAG2268360.16662843562339302No Hit
ACGCGGGAGACCGGGGTTCGATTCCCCGACGGGGAGCCGCCTTGGCCGTACA2264660.1663566422520558No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCCGCCTTGGCCGTACAGCA2232440.16398983619138388No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCCGCCTTGGCCGTACAGCA2079860.1527816652187793No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGGGACTCCGCCTTGGCCGTACAGCA1985130.14582302033586653No Hit
GTATTTGCCCTTAAGCACGGCAGAAACTGCCTGCATCTCTCGCCTTGGCCGT1965810.14440381819147852No Hit
ACGCGGGAGACCGGGGTTCGATTCCCCGACGGGGAGCGCCTTGGCCGTACAG1914610.14064278559351448No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTCCGCCTTGGCCGTACAG1890280.1388555605328023No Hit
ACCTCGGCCGGCGAGCGCGCCGGCCTTCACCTTCCGCCCTGGCCGTACAGCA1848820.13581000562046655No Hit
TAAAATTTAAGGAGAGGGTATCAAGCACATTAACGCCTTGGCCGTACAGCAG1766980.12979823007715838No Hit
ACGCGGGAGACCGGGGTTCGATTCCCCGACGGGGACGCCTTGGCCGTACAGC1710900.1256787240597009No Hit
CGCCTTGGCCGTACAGCAGCTCCTGATCGTATGCCGTCTTCTGCTTGAAAAA1689390.12409864962254842Illumina Single End Adapter 2 (95% over 23bp)
CTTGGCCGTACAGCAGACGCCAATCGTATGCCGTCTTCTGCTTGAAAAAAAA1647250.12100314349602098Illumina Single End Adapter 1 (95% over 22bp)
ATTCTTGCGACCCGGGTTCGTTTCCCGGGCGGCGCACCCGCCTTGGCCGTAC1634480.12006508907656784No Hit
AATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCGCCTTGGCCGT1563400.11484371804017558No Hit
AAAATTTAAGGAGAGGGTATCAAGCACATTAACGCCTTGGCCGTACAGCAGA1557840.11443529340649042No Hit
AAGCAGTTGACCCGGGTTCGTTTCCCGGCCAACGCACCACGCCTTGGCCGTA1539220.11306751162965271No Hit
CTTGGCCGTACAGCAGTGAGTCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA1536880.11289562068669888Illumina PCR Primer Index 8 (96% over 27bp)
AGAGAAATAGAGCCACCTTACAAATAAGCGCTCTCCGCCTTGGCCGTACAGC1516490.11139781883762687No Hit
GCGCCGCTGGTGTAGTGGTATCATGCAAGATTCCGCCTTGGCCGTACAGCAG1448630.10641298149196593No Hit
ACGCGGGAGACCGGGGTTCGATTCCCCGACGGGGAGCCACGCCTTGGCCGTA1447610.10633805467067836No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCGCCTTGGCCGTACAGCAG1446140.10623007189882276No Hit
ACCCAGGCGGCCCGGGTTCGACTCCCGGTGTGGGCGCCTTGGCCGTACAGCA1423790.10458829302060993No Hit
GAATACAAGCTTGGGCTGCAGGTCGACCCGTCGCCTTGGCCGTACAGCAGAT1416420.10404691000797331No Hit
CGGGGCCCGCGCGGCCAACCCCCGGGACGGGGACCGCCTTGGCCGTACAGCA1396990.10261962752011312No Hit
GTGATCGCCTTGGCCGTACAGCAGATCTGCTCGTATGCCGTCTTCTGCTTGA1361800.10003465218569214TruSeq Adapter, Index 23 (96% over 26bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGGCTAG3016900.044.6411484
GAATACA2143450.044.511031
GCTAGCT3034250.044.4737666
CCGGCTA3103200.044.3596653
GGCTAGC3037800.044.3394475
AATACAA2176850.044.3023262
CTAGCTC3133150.044.277217
GCCCGGA8841350.044.1223681
CCTCTCT4608550.043.742421
CTCTCTA4552000.043.4337042
TGCACGA681950.043.366561
GAGCATG3273950.042.66763322
GAAGTCA1970300.042.663152
CATTGGT1393100.042.5279542
GTATCAT574300.042.48196818
CCCGGAT9318300.042.4686362
GTCGGTA13331100.042.45659615
TCGGTAG13329900.042.43017216
CTCAGTC13397000.042.39557311
CGGTAGA13373450.042.3323817