FastQCFastQC Report
Mon 3 Apr 2017
fastq2_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq2_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences84493538
Sequences flagged as poor quality0
Sequence length52
%GC60

[OK]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
CGCCTTGGCCGTACAGCAGTCTGAGTCGTATGCCGTCTTCTGCTTGAAAAAA14419431.706571927429527Illumina Single End Adapter 1 (95% over 22bp)
CGCCTTGGCCGTACAGCAGTATATGTCGTATGCCGTCTTCTGCTTGAAAAAA13234461.5663280664137889TruSeq Adapter, Index 6 (96% over 26bp)
ACGCGGGAGACCGGGGTTCGATTCCCCGACGGGCGCCTTGGCCGTACAGCAG11397921.3489694324316257No Hit
GCCCGGATAGCTCAGTCGGTAGAGCATCAGACTCGCCTTGGCCGTACAGCAG10858081.285078155917675No Hit
ACCTCGGCCGGCGAGCGCGCCGGCCTTCACCTTCCGCCTTGGCCGTACAGCA9383901.1106056418184311No Hit
ACGCGGGAGACCGGGGTTCGATTCCCCGACGGGGCGCCTTGGCCGTACAGCA8999541.0651157725221543No Hit
CGCCTTGGCCGTACAGCAGTGAGTCTCGTATGCCGTCTTCTGCTTGAAAAAA8977351.062489536182045TruSeq Adapter, Index 15 (96% over 28bp)
CGCCTTGGCCGTACAGCAGTGCTCGTCGTATGCCGTCTTCTGCTTGAAAAAA8607531.0187205085435054Illumina Single End Adapter 1 (95% over 22bp)
GCCCGGATAGCTCAGTCGGTAGAGCATCAGACCGCCTTGGCCGTACAGCAGT6895160.816057672954824No Hit
ACCGGGGCCCGCGCGGCCAACCCCCGGGACGGGGACCGCCTTGGCCGTACAG6750580.7989463052192228No Hit
AGGTTCCCCACGAACGTGCGGTGCGTGACGGGCCGCCTTGGCCGTACAGCAG6325880.7486821063168168No Hit
CGCCTTGGCCGTACAGCAGCCTTCCATCGTATGCCGTCTTCTGCTTGAAAAA5582010.6606434210388965Illumina Single End Adapter 1 (95% over 22bp)
CTTGGCCGTACAGCAGTGAGTCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA5416740.6410833453322786Illumina PCR Primer Index 8 (96% over 27bp)
GCCCGGATAGCTCAGTCGGTAGAGCATCAGACTTCGCCTTGGCCGTACAGCA5392010.6381564942871726No Hit
GAATACAAGCTTGGGCTGCAGGTCGACCCGTGCCGCCTTGGCCGTACAGCAG5353090.6335502248704511No Hit
CGCCTTGGCCGTACAGCAGGAGCCTTTCGTATGCCGTCTTCTGCTTGAAAAA4769310.564458550664549TruSeq Adapter, Index 16 (96% over 25bp)
CGCCTTGGCCGTACAGCAGACGCCAATCGTATGCCGTCTTCTGCTTGAAAAA4577920.5418071142907993Illumina Single End Adapter 1 (95% over 22bp)
AACCCCCGGGACGGGGACCGGCGGGCCACGGGCCCGGCTCCGCCTTGGCCGT4410110.5219464238791847No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCGCCTTGGCCGTACAGCAG3569460.4224536082274126No Hit
TTGGCCGTACAGCAGTGAGTCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAA3129820.37042122676884476TruSeq Adapter, Index 15 (96% over 28bp)
CGGGGCCCGCGCGGCCAACCCCCGGGACGGGGACCGCCTTGGCCGTACAGCA3020790.3575172813807371No Hit
AAACCACGCTCCCCGGACCCCGTCCCGGCCCGGAGCGGACCGCCTTGGCCGT2976980.3523322694807738No Hit
CTCCCCCGGGCCCGACGGCGCGACCCGCCCGGGGCGCCGCCTTGGCCGTACA2768940.32771026821009674No Hit
CCTCTCTATGGGCAGTCGGTGATCGCCTTGGCCGTACAGCAGTATATGTCGT2661890.31504066026919125ABI Solid3 Adapter B (100% over 23bp)
CGCGGGAGACCGGGGTTCGATTCCCCGACGGGGCGCCTTGGCCGTACAGCAG2315790.2740789479072352No Hit
CGCGGGAGACCGGGGTTCGATTCCCCGACGGGCGCCTTGGCCGTACAGCAGT2257030.26712456992864947No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACCGCCTTGGCCGTACAGCAGT2154090.25494138971905755No Hit
GAATACAAGCTTGGGCTGCAGGTCGACCCGTGCGGACGCCTTGGCCGTACAG2135360.25272465215032186No Hit
GAGAAATAGAGCCACCTTACAAATAAGCGCTCTCCGCCTTGGCCGTACAGCA1991290.23567364406021202No Hit
TGGCCGTACAGCAGTGAGTCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAA1979690.23430075800589625Illumina PCR Primer Index 8 (96% over 27bp)
CTTGGCCGTACAGCAGTATATGTCGTATGCCGTCTTCTGCTTGAAAAAAAAA1950880.23089102979685855RNA PCR Primer, Index 44 (96% over 26bp)
CTTGGCCGTACAGCAGACGCCAATCGTATGCCGTCTTCTGCTTGAAAAAAAA1938780.2294589676195119Illumina Single End Adapter 1 (95% over 22bp)
GCCCGGATAGCTCAGTCGGTAGAGCATCAGACCGCCTTGGCCGTACAGCAGA1938340.22940689263124475No Hit
GGACGGCGCCGGACGCGCACGCCCCGCCGGGCCCCCCGCCGCCTTGGCCGTA1860810.2202310429940808No Hit
GCCCGGATAGCTCAGTCGGTAGAGCATCAGACGCCTTGGCCGTACAGCAGTG1753320.20750936006490817No Hit
CGCCTTGGCCGTACAGCAGATACCTATCGTATGCCGTCTTCTGCTTGAAAAA1745660.20660278186007552TruSeq Adapter, Index 16 (96% over 25bp)
ACGCGGGAGACCGGGGTTCGATTCCCCGACGGGGAGCCGCCTTGGCCGTACA1679000.1987134211376023No Hit
GCCCGGATAGCTCAGTCGGTAGAGCATCAGACGCCTTGGCCGTACAGCAGTA1676040.1983630984892596No Hit
ACCGGGGCCCGCGCGGCCAACCCCCGGGACGGGGACCCGCCTTGGCCGTACA1663480.19687659427872461No Hit
ACGCGGGAGACCGGGGTTCGATTCCCCGACGGGGACGCCTTGGCCGTACAGC1518270.17969066462810446No Hit
CTTGGCCGTACAGCAGTCTGAGTCGTATGCCGTCTTCTGCTTGAAAAAAAAA1501920.1777556054049956Illumina Single End Adapter 1 (95% over 22bp)
ACGCGGGAGACCGGGGTTCGATTCCCCGACGGGGAGCGCCTTGGCCGTACAG1480790.17525482244571178No Hit
GCGGGAGACCGGGGTTCGATTCCCCGACGGGGCGCCTTGGCCGTACAGCAGT1469470.17391507502029327No Hit
GAGCCGCCCCGGCGGTGAACGGGGAGGAGGCGGGAACCGCCTTGGCCGTACA1393280.16489781739285198No Hit
GCCGTGGGAGGGGTGGCCCGGCCCCCCCACGAGGAGACCGCCTTGGCCGTAC1385030.1639214113628429No Hit
ACGCGGGAGACCGGGGTTCGTTTCCCCGACGGGCGCCTTGGCCGTACAGCAG1323180.15660132494392648No Hit
CCTCTCTATGGGCAGTCGGTGATCGCCTTGGCCGTACAGCAGCCTTCCATCG1312020.15528051387787786ABI Solid3 Adapter B (100% over 23bp)
CGGGGCCCGCGCGGCCAACCCCCGGGACGGGGACCCGCCTTGGCCGTACAGC1308360.15484734465729202No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCCGCCTTGGCCGTACAGCA1288340.1524779326911367No Hit
GGGGCCCGCGCGGCCAACCCCCGGGACGGGGACCCGCCTTGGCCGTACAGCA1280530.15155360164939477No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCCGCCTTGGCCGTACAGCA1276950.15112990060849388No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTCCGCCTTGGCCGTACAG1258900.1489936425670801No Hit
GCCCGGATAGCTCAGTCGGTAGAGCATCAGACGCCTTGGCCGTACAGCAGCC1244690.1473118571505433No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCCCGCCTTGGCCGTACAGC1244310.14726688329703982No Hit
TGCACGAGGCCCCGGGTTCAATCCCCGGCACCTCCACCACGCCTTGGCCGTA1220350.1444311634814014No Hit
AACAAAATCAAAAAGTAAGTTTAGATTATAGCCCGCCTTGGCCGTACAGCAG1218480.144209844781266No Hit
CCTCTCTATGGGCAGTCGGTGATCGCCTTGGCCGTACAGCAGACGCCAATCG1173640.13890293006785917ABI Solid3 Adapter B (100% over 23bp)
AGAAGTCAGCAACTTGATTCCAGCAGTAGTCGCCTTGGCCGTACAGCAGTAT1160410.1373371298524628No Hit
GCCCGGATAGCTCAGTCGGTAGAGCATCAGACCGCCTTGGCCGTACAGCAGC1145030.1355168723080338No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCCGCCTTGGCCGTACAGCA1123760.13299952003430132No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCGCCTTGGCCGTACAGCAG1119860.13253794627466067No Hit
ACGCGGGAGACCGGGGTTCGTTTCCCCGACGGGGCGCCTTGGCCGTACAGCA1116240.1321095111439173No Hit
AGAGAAATAGAGCCACCTTACAAATAAGCGCTCTCCGCCTTGGCCGTACAGC1071510.12681561517757725No Hit
AGACTATAGGCAATAATCACACTATAAATAATCCCGCCTTGGCCGTACAGCA1055950.12497405422885713No Hit
TTGGCCGTACAGCAGTATATGTCGTATGCCGTCTTCTGCTTGAAAAAAAAAA1031280.12205430431851487Illumina PCR Primer Index 6 (96% over 26bp)
GAATACAAGCTTGGGCTGCAGGTCGACCCGTGCGCCTTGGCCGTACAGCAGT1023080.1210838159008089No Hit
CTTGGCCGTACAGCAGTGCTCGTCGTATGCCGTCTTCTGCTTGAAAAAAAAA1022440.12100807046332938Illumina Single End Adapter 1 (95% over 22bp)
GCCCGGATAGCTCAGTCGGTAGAGCATCAGACTTTCGCCTTGGCCGTACAGC1005320.11898188001075302No Hit
ACGCCCGCGGTCGGCGGGAGAGGCCGGGAGGGAGGAAGACCGCCTTGGCCGT965910.11431761799346123No Hit
AACCCCCGGGACGGGGACCGGCGGGCCACGGGCCCGGCCGCCTTGGCCGTAC958700.11346429829935635No Hit
CCTCTCTATGGGCAGTCGGTGATTTTGGTGACTCTAGATAACCTCGGGCCGA957220.113289136975185ABI Solid3 Adapter B (100% over 23bp)
ACGCGGGAGACCGGGGTTCGATTCCCCGACGGGGAGCCACGCCTTGGCCGTA957150.1132808523179607No Hit
CGCCTTGGCCGTACAGCAGGTGAGCTCGTATGCCGTCTTCTGCTTGAAAAAA956380.11318972108849319Illumina PCR Primer Index 5 (96% over 27bp)
AACCCCCGGGACGGGGACCGGCGGGCCACGGGCCCGGCCCCGCCTTGGCCGT927900.10981904912065582No Hit
ACCTCGGCCGGCGAGCGCGCCGGCCTTCACCTTCCGCCCTGGCCGTACAGCA908840.10756325531071974No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGGGACTCGCCTTGGCCGTACAGCAG894590.10587673580434045No Hit
TTGGCCGTACAGCAGTCTGAGTCGTATGCCGTCTTCTGCTTGAAAAAAAAAA851700.10080060797075392Illumina Single End Adapter 1 (95% over 22bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GAATACA2135100.045.0391921
AATACAA2152600.044.957972
ATACAAG2223400.043.8675423
CGGCTAG1490000.043.860414
TACAAGC2232800.043.669864
GGCTAGC1500200.043.5898865
GCTAGCT1502000.043.581816
ACGCGGG4203700.043.4973071
CTAGCTC1548950.043.449887
CTCTCTA2293300.043.1832852
TGCACGA242300.043.154641
CCGGCTA1550200.043.0581173
CCTCTCT2365850.043.0219351
ACAAGCT2270050.042.869295
GTATCAT321400.042.68775618
CAAGCTT2328400.042.675636
GGGGGTA141500.042.5307661
TCTCTAT2356850.042.081233
GAGCATG1623250.042.06097822
CCCGGAT4804600.042.0595252