FastQCFastQC Report
Mon 3 Apr 2017
fastq1_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq1_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences247378749
Sequences flagged as poor quality0
Sequence length49-102
%GC57

[OK]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[WARN]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
GTCTAGGGGTATGATTCTCGCTTAGATCGGAAGAGCACACGTCTGAACT64880982.6227386249738047Illumina Multiplexing PCR Primer 2.01 (100% over 26bp)
CGCGGGAGACCGGGGTTCGATTCCCCGACGGGAGATCGGAAGAGCACAC18250790.7377670908991458No Hit
CGCCGCTGGTGTAGTGGTATCATGCAAGATTAGATCGGAAGAGCACACG16548800.668966112364001No Hit
CTGGTGTAGTGGTATCATGCAAGATTAGATCGGAAGAGCACACGTCTGA15144840.612212652106184Illumina Multiplexing PCR Primer 2.01 (100% over 23bp)
GGGAGACCGGGGTTCGATTCCCCGACGGGAGATCGGAAGAGCACACGTC15053840.6085340822869146No Hit
GAATACAAGCTTGGGCTGCAGGTCGACCCGAGATCGGAAGAGCACACGT12080570.4883430791381356No Hit
CGGGAGACCGGGGTTCGATTCCCCGACGGGAGATCGGAAGAGCACACGT11031560.4459380623676773No Hit
GGGAGACCGGGGTTCGATTCCCCGACGGAGATCGGAAGAGCACACGTCT9068170.3665702909670709Illumina Multiplexing PCR Primer 2.01 (100% over 21bp)
CGCGGGAGACCGGGGTTCGATTCCCCGACGGAGATCGGAAGAGCACACG8982010.3630873725535737No Hit
GTCTAGCGGTTAGGATTCCTGGAGATCGGAAGAGCACACGTCTGAACTC7617330.30792176089466766Illumina Multiplexing PCR Primer 2.01 (100% over 27bp)
CGCTGGTGTAGTGGTATCATGCAAGATTAGATCGGAAGAGCACACGTCT7580440.3064305252833177Illumina Multiplexing PCR Primer 2.01 (100% over 21bp)
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTAT6958640.28129497897978295TruSeq Adapter, Index 8 (100% over 48bp)
CGGGAGACCGGGGTTCGATTCCCCGACGGAGATCGGAAGAGCACACGTC6937400.28043637652965897No Hit
CGCCGCGGCCCGGGTTCGATTCCCGGTCAGGGAGATCGGAAGAGCACAC6784130.2742406139340611No Hit
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTAT6136570.24806374940476394TruSeq Adapter, Index 6 (100% over 48bp)
GAATACAAGCTTGGGCTGCAGGTCGACAGATCGGAAGAGCACACGTCTG5751480.23249693125418788Illumina Multiplexing PCR Primer 2.01 (100% over 22bp)
ATCGTATAGTGGTTAGTACTCTGCGAGATCGGAAGAGCACACGTCTGAA5605830.2266091983511486Illumina Multiplexing PCR Primer 2.01 (100% over 24bp)
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTAT5048290.20407128827383633TruSeq Adapter, Index 2 (100% over 48bp)
CGCGGGAGACCGGGGTTCGATTCCCCGACGGGGAGATCGGAAGAGCACA4817720.19475076252406792No Hit
CCAGGCGGCCCGGGTTCGACTCCCGGTATGGGAGATCGGAAGAGCACAC4567610.18464035485926078No Hit
GCGCCGCTGGTGTAGTGGTATCATGCAAGATTAGATCGGAAGAGCACAC4171870.16864302276829768No Hit
CCAGGCGGCCCGGGTTCGACTCCCGGTGTGGGAGATCGGAAGAGCACAC4161090.16820725372816886No Hit
ATCGTATAGTGGTTAGTACTCTGCAGATCGGAAGAGCACACGTCTGAAC4155300.16797319967043733Illumina Multiplexing PCR Primer 2.01 (100% over 25bp)
GTATAGTGGTGAGTATCCCCGCAGATCGGAAGAGCACACGTCTGAACTC3967600.16038564412014228Illumina Multiplexing PCR Primer 2.01 (100% over 27bp)
CGGGAGACCGGGGTTCGATTCCCCGACGGGGAGATCGGAAGAGCACACG3433800.13880739610337345No Hit
GGGAGACCGGGGTTCGATTCCCCGACGGGGAGATCGGAAGAGCACACGT3422420.13834737275674394No Hit
AAGCTTGGGCTGCAGGTCGACCCGTGCAGATCGGAAGAGCACACGTCTG3416690.1381157441296625Illumina Multiplexing PCR Primer 2.01 (100% over 22bp)
GTATAGTGGTGAGTATCCCCGAGATCGGAAGAGCACACGTCTGAACTCC3416440.13810563816862054Illumina Multiplexing PCR Primer 2.01 (100% over 28bp)
TTCTTGCGACCCGGGTTCGATTCCCGGGCGGCGAGATCGGAAGAGCACA3392610.13714233796210198No Hit
CGCCGCGGCCCGGGTTCGATTCCCGGTCAGGAGATCGGAAGAGCACACG3294030.13315735540404078No Hit
TGCGAGAGGTCCCGGGTTCAGATCGGAAGAGCACACGTCTGAACTCCAG3098140.12523872857001148Illumina Multiplexing PCR Primer 2.01 (100% over 30bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGAAGATCGGAAGAGCACACG3056400.12355143731444775No Hit
GTGTAGTGGTATCATGCAAGATTAGATCGGAAGAGCACACGTCTGAACT2951070.11929359380825391Illumina Multiplexing PCR Primer 2.01 (100% over 26bp)
GTCTAGTGGTTAGGATTCGGCGAGATCGGAAGAGCACACGTCTGAACTC2846250.11505636646258569Illumina Multiplexing PCR Primer 2.01 (100% over 27bp)
TCTTGCGACCCGGGTTCGATTCCCGGGCGGCGAGATCGGAAGAGCACAC2758270.1114998766527031No Hit
CGCCGCGGCCCGGGTTCGATTCCCGGTCAGATCGGAAGAGCACACGTCT2606730.10537404730751548Illumina Multiplexing PCR Primer 2.01 (100% over 21bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCCGTAT4163150.0133.0812896
GGGGTAT10763300.075.836446
AGGGGTA10789900.075.6392065
GGGTATG10784750.075.598937
GGTATGA10814350.075.39648
GTATGAT10887650.074.918259
TAGGGGT11003450.073.8706364
GGCTAGC1734700.071.057155
GCTAGCT1742650.070.7716456
TATGCGA4430150.068.0118146-47
GTATGCG4446000.067.8553146-47
CGGCTAG1805100.067.79784
TACAAGC4629350.066.7774354
ACTCGCA3737500.066.5140248-49
CGCCGTA4169500.066.30356694-95
TCTAGGG12002400.066.233932
ATACCCC4508250.066.111562-63
CTAGGGG12046900.065.992663
TCATACC4514100.065.9879160-61
AATCATA4525900.065.9548258-59