FastQCFastQC Report
Tue 11 Apr 2017
fastq2_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq2_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences24104093
Sequences flagged as poor quality0
Sequence length51
%GC48

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
ACCGCTTGGGAACACCGCGTGTTGTTGGCCTCTGTAGGCACCATCAATATC1456710.6043413456793416No Hit
ATGTACACGGAGTCGAGCACCCGCAACGCGACTCTGTAGGCACCATCAATA725540.30100282138805223No Hit
ATGTACACGGAGTCGAGCACCCGCAACCTGTAGGCACCATCAATATCTCGT516160.2141379059564697No Hit
ATCCAGCTGGATAACGCAGAAGATATAGTCCTGTAGGCACCATCAATATCT358940.1489124689321436No Hit
ACAAAAGTATGAAACAAGAAACACGTGTTCCCTGTAGGCACCATCAATATC319900.1327160495107615No Hit
ACGCCAGCAAGATGAAAATTGGCTTGTGCGCCTGTAGGCACCATCAATATC318560.132160127327753No Hit
ATCCAGCTGGATAACGCAGAAGATATAGTCACTGTAGGCACCATCAATATC304040.12613625412082502No Hit
ATGTACACGGAGTCGAGCACCCGCAACGCCTGTAGGCACCATCAATATCTC280100.11620433094080744No Hit
ATGGAACAAAAGTATGAAACAAGAAACACGTGCTGTAGGCACCATCAATAT278040.11534970430125706No Hit
ATGTACACGGAGTCGAGCACCCGCAACGCTGTAGGCACCATCAATATCTCG277690.11520450074599363No Hit
ACAATGCCTCCGAAAACTAGTGGAAAGGCAGCCCTGTAGGCACCATCAATA267910.11114709854463307No Hit
ATGGAACAAAAGTATGAAACAAGAAACACGCTGTAGGCACCATCAATATCT244710.10152217716717239No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GTACACG323350.041.7597243
ATGTACA340000.040.8557551
TACACGG335250.040.370794
CCGCTTG186250.040.1940882
ACCGCTT190200.040.051731
AGTCGAG302650.039.6310711
CGGAGTC341400.039.0275158
CGCTTGG189050.038.9258733
GAGTCGA340550.038.76832210
ACCGCGT187150.038.75767514
TGTACAC349600.038.7527772
GCGTGTT188850.038.74219517
GTGTTGT188900.038.74192419
CTTGGGA191050.038.6826745
TGGGAAC191650.038.588417
CGCGTGT188650.038.4852816
CCGCGTG189550.038.33815815
GGGAACA193700.038.040638
ACGGAGT353650.037.8283357
TTGTTGG191950.037.61055422