FastQCFastQC Report
Tue 13 Dec 2016
fastq1_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq1_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences35739774
Sequences flagged as poor quality0
Sequence length40
%GC58

[OK]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGTCGTATGCC22922946.413845817827498No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCGTATGC16714954.676848264345488No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCTCGTATGCCG6337411.7732093101651958No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGATCGTATGCC6215951.739224763984238No Hit
TCCTCGTTAGTATAGTGGTGAGTATCCCCGCTCGTATGCC3990701.116599114476773No Hit
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGTCGTATGCCG3817191.0680509619338947No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGGTCGTATGCCGT3729771.0435908184534126No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGGGATCGTATGCC2810590.7864039655091271No Hit
TCCTCGTTAGTATAGTGGTGAGTATCCCCGTCGTATGCCG2013850.5634758630538627No Hit
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTCGTATGCC1984510.5552665218308319No Hit
CGCCGCGGCCCGGGTTCGATTCCCGGTCAGGGATCGTATG1840360.5149333065172712No Hit
CGCAGCAACCTCGGTTCGAATCCGAGTCACGGTCGTATGC1726700.4831312027882437No Hit
CGCCGCTGGTGTAGTGGTATCATGCAAGATTTCGTATGCC1642550.4595860063356864No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCTCGTATGCCG1449140.4054698275372418No Hit
TCCCTGGTGGTCTAGTGGCTAGGATTCGGCGTCGTATGCC1382400.38679595455751903No Hit
CCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCGTATGCC1353190.3786229873753539No Hit
GCATGGGTGGTTCAGTGGTAGAATTCTCGCTCGTATGCCG1335140.37357259170133533No Hit
TCCCACATGGTCTAGCGGTTAGGATTCCTGGTTCGTATGC1332390.37280314083687266No Hit
CGCCGCGGCCCGGGTTCGATTCCCGGTCAGGGTCGTATGC1079780.3021227834289047No Hit
CCCTGGTGGTCTAGTGGTTAGGATTCGGCGTCGTATGCCG1028470.28776622929960327No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCTGGTTCGTATGC1027240.28742207491295274No Hit
TCCCTGGTGGTCTAGTGGCTAGGATTCGGCGCTCGTATGC971350.27178403534392803No Hit
TCCCTGGTCTAGTGGTTAGGATTCGGCGTCGTATGCCGTC953330.26674203367933996No Hit
TCCGTAGTGTAGTGGTTATCACGTTCGCTCGTATGCCGTC946230.26475545144745455No Hit
CGCAGCAACCTCGGTTCGAATCCGAGTCACGGCTCGTATG923460.2583843982897038No Hit
CAGGATGGCCGAGCGGTCTAAGGCTGCGTTTCGTATGCCG876590.24527015755611664No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGCTCGTATGCC840940.2352952763495371No Hit
GCGCCGCTGGTGTAGTGGTATCATGCAAGATTTCGTATGC813650.227659525770924No Hit
CGCAGCAACCTCGGTTCGTATCCGAGTCACGGTCGTATGC797160.22304561858729155No Hit
TCCCTGTGGTCTAGTGGTTAGGATTCGGCTCGTATGCCGT747110.20904161285407122No Hit
TTCCGTAGTGTAGTGGTTATCACGTTCGCTCGTATGCCGT736990.20621003367284862No Hit
ATCCAGCGATCCGAGTTCAAATCTCGGTGGGATCGTATGC734720.20557488695927398No Hit
CGCAGCAACCTCGGTTCGTATCCGAGTCACGGCTCGTATG712090.1992430058455322No Hit
GGTAGCGTGGCCGAGCGGTCTAAGGCCTGGTCGTATGCCG665610.18623788723454154No Hit
CGCCGCGGCCCGGGTTCGTTTCCCGGTCAGGGATCGTATG660090.18469338949932923No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGGTCGTCTGCCGT650980.18214440863560022No Hit
TCCCTGTGGTCTAGTGGTTAGGATTCGGTCGTATGCCGTC610930.17093840604588043No Hit
CGCAGCAACCTCGGTTCGAATCCGAGTCACGTCGTATGCC609390.17050751356178134No Hit
ATCCAGCGATCCGAGTTCATATCTCGGTGGGATCGTATGC592600.1658096662838439No Hit
AGCAGAGTGGCGCAGCGGAAGCGTGCTGGGTCGTATGCCG576700.16136084128567796No Hit
GCGTTGGTGGTATAGTGGTGAGCATAGCTGTCGTATGCCG575940.16114819304677191No Hit
CAGGATGGCCGAGCGGTCTAAGGCGCTGCGTTTCGTATGC543560.15208825886811708No Hit
TCCCTGTGGTCTAGTGGCTAGGATTCGGCGTCGTATGCCG539890.15106139171445235No Hit
TCCATGGTGTAATGGTTAGCACTCTGGACTTCGTATGCCG517300.14474070261328456No Hit
GGTAGCGTGGCCGAGCGGTCTAAGGCTCTGGTCGTATGCC512230.14332211501952977No Hit
TCCCACATGGTCTAGCGGTTAGGATTCCTGGTCGTATGCC507320.14194829547607102No Hit
GCATGGGTGGTTCAGTGGTAGAATTCTCGTCGTATGCCGT490570.13726164021070755No Hit
TCCTCGTTAGTATAGTGGTGAGTATCCCCGCCTCGTATGC490550.13725604420442053No Hit
CAGGAGATCCTGGGTTCGAATCCCAGCGGGGCCTCGTATG482150.13490572156388006No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGGGACTCGTATGC477620.1336382261398743No Hit
AGCAGAGTGGCGCAGCGGAAGCGTGCTGGGCTCGTATGCC474580.13278763318425013No Hit
CGTTGGTGGTATAGTGGTGAGCATAGCTGCTCGTATGCCG469170.1312739134836163No Hit
CGCAGCAACCTCGGTTCGTATCCGAGTCACGTCGTATGCC455960.12757775133105206No Hit
TCCTCTTTGTATAGTGGTGAGTATCCCCGCTCGTATGCCG454740.127236394947545No Hit
CATGGGTGGTTCAGTGGTAGAATTCTCGCTCGTATGCCGT436390.12210205917922144No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCTGGTCGTATGCC429360.12013506296934054No Hit
TCCCTGGTCTAGTGGTTAGGATTCGGCGCTCGTATGCCGT427090.11949991625576592No Hit
ATCCAGCGATCCGAGTTCATATCTCGGTGGATCGTATGCC426730.1193991881425999No Hit
GCGTTGGTGGTATAGTGGTTAGCATAGCTGTCGTATGCCG425930.11917534789111985No Hit
ATCCAGCGATCCGAGTTCAAATCTCGGTGGATCGTATGCC419630.1174126059107145No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCGTATGC412360.11537845762538956No Hit
GCCTGGATAGCTCAGTCGGTAGAGCATCAGATCGTATGCC404610.11321000518917664No Hit
TGCGAGAGGTCCCGGGTTCATATCCCGGACGAGTCGTATG398760.1115731733502288No Hit
TCCTCTTTAGTATAGTGGTGAGTATCCCCGCTCGTATGCC393570.110121009718752No Hit
GCGTTGGTGGTATAGTGGTGAGCATAGCTGCTCGTATGCC392860.10992235149556347No Hit
TTCCATGGTGTAATGGTTAGCACTCTGGATCGTATGCCGT389470.10897382842991676No Hit
GCCCGGATAGCTCAGTCGGTAGAGCATCAGATCGTATGCC389140.10888149432618124No Hit
TTCCATGGTGTAATGGTTAGCACTCTGGACTTCGTATGCC375540.10507621005102048No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGGGCTCGTATGCC375280.10500346196928945No Hit
CGCCGCTGGTGTAGTGGTATCATGCACGATTTCGTATGCC370660.10371078451699219No Hit
TGCGAGAGGTCCCGGGTTCAAATCCCGGACGAGTCGTATG368030.10297490969025155No Hit
TCCAGCGATCCGAGTTCAAATCTCGGTGGGATCGTATGCC366770.10262236129417047No Hit
GGCATTAACGCGAACTCGGCCTACAATAGTGACTCGTATG359860.10068894112201157No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TCCCATA187250.033.1107031
GTAGCGT354200.032.9554672
TCCCTGG6304550.032.901561
CCTCGTT948650.032.8638762
CTCGTTA845200.032.5581053
GCCCGGC1444200.032.539981
TCCCACA234850.032.52321
TAGTATA931900.032.4997528
AGTATAG933600.032.434799
CCTCTTT321000.032.42542
CCGGCTA1467750.032.4119153
GCTAGCT1413300.032.376816
TAGCGTG359900.032.3648343
CGGCTAG1432200.032.2783744
CGTTAGT848000.032.2743575
CTAGCTC1440400.032.2614867
TCCTCTT333250.032.2350161
TCGTTAG855950.032.166454
GGCTAGC1423850.032.1605725
GTCGGTA1602700.032.08165715