FastQCFastQC Report
Mon 3 Apr 2017
fastq1_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq1_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences7455053
Sequences flagged as poor quality0
Sequence length25-33
%GC53

[FAIL]Per base sequence quality

Per base quality graph

[FAIL]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CTAAACCATTCGTATGCCGTCTTCTGCTT533170.7151793555324154Illumina PCR Primer Index 1 (95% over 21bp)
ATGTACACGGAGTCGACCCGCAACGC478170.6414038907570476No Hit
ATGTACACGGAGTCGACCCGCAACG175460.2353571463542915No Hit
CTAAACCATTCGTATGCCGTCTTCTGCTTG141470.18976390912311422Illumina PCR Primer Index 1 (95% over 22bp)
ATGTACACGGAGTCGACCCGCAACGCG119670.16052199763033206No Hit
TAAACCATTCGTATGCCGTCTTCTGCTT95210.12771203638659578Illumina Paired End PCR Primer 2 (95% over 21bp)

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGATCAC26650.0256.2195427
CGATCCC29500.0147.5481327
CGAACAC10000.0146.902627
CGCTCAC8100.0117.5489527
CAAACAC12700.0107.1030927
CGATCGC33300.0103.53528626
GATCGCC10500.095.86236627
AAAACAC14100.094.5393727
CGACCAC10100.091.57844527
ACGATAC2700.090.6806227
CCGATCC44800.089.8709727
CCGATCA24200.089.731226
TCGACAC22750.083.70518527
CAATCAC15200.076.95920627
ACTCGGC11950.075.12453527
CGAAAAC11600.075.0460327
AATACAT12700.072.830127
CAAAAAC24700.069.387227
AAAAAAC55700.065.93474627
CAATCCC17800.065.7179827