FastQCFastQC Report
Mon 3 Apr 2017
fastq2_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq2_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences4557383
Sequences flagged as poor quality0
Sequence length25-33
%GC54

[FAIL]Per base sequence quality

Per base quality graph

[FAIL]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
CTAAACCATTCGTATGCCGTCTTCTGCTT489991.0751565097776508Illumina PCR Primer Index 1 (95% over 21bp)
ATGTACACGGAGTCGACCCGCAACGC455100.9985994154978856No Hit
ATGTACACGGAGTCGACCCGCAACG152300.33418301687613267No Hit
CTAAACCATTCGTATGCCGTCTTCTGCTTG128840.282706105675121Illumina PCR Primer Index 1 (95% over 22bp)
ATGTACACGGAGTCGACCCGCAACGCG114650.25156981539624823No Hit
TAAACCATTCGTATGCCGTCTTCTGCTT88740.19471701193426139Illumina Paired End PCR Primer 2 (95% over 21bp)
CTAAACCATTCGTATGCCGTCTTCTTCTT49830.10933906586301832No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGATCAC21500.0201.8845827
CAATCAC8450.0123.4785627
CAAACAC6450.0122.9425327
CGATCCC20900.0117.81863427
CGAACAC6850.0106.6241827
CTATCAC3250.0102.7341627
AAAACAC10550.0100.8778927
GATCGCC8900.0100.8223327
AATACAT7850.090.3831627
CGTTCCC3950.084.52811427
CGATCGC30500.082.54932426
CCGATCC37350.070.9563727
TCGACAC20500.069.22027627
CGAAAAC9150.068.4192727
CGCTCAC5000.066.777227
CCGATCA20050.064.4153726
CAATCCC12500.063.43834727
GAACGAT6000.062.6036327
CGACCAC6700.062.29216827
CAATCGC5300.057.49860426