FastQCFastQC Report
Mon 3 Apr 2017
fastq2_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq2_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences9702632
Sequences flagged as poor quality0
Sequence length25-33
%GC56

[FAIL]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGTACACGGAGTCGACCCGCAACGC164551516.959470378759082No Hit
ATGTACACGGAGTCGACCCGCAACG2845212.9324105046960454No Hit
GCCGTGATCGTATAGTGGTTAGTACTCTG1457741.5024170761088331No Hit
CCCTGGTGGTCTAGTGGTTAGGATTCGG1260391.2990186580301097No Hit
CCCCTGGTGGTCTAGTGGTTAGGATTCGG987561.0178269154184143No Hit
CCCTGGTGGTCTAGTGGTTAGGATTCGGC432410.4456625789785699No Hit
CCTGGTGGTCTAGTGGTTAGGATTCGG425950.439004591743766No Hit
GCAGCAACCTCGGTTCGTATCCGAGTCACGG376780.38832762079402783No Hit
TTGGTGGTTCAGTGGTAGAATTCTCG372660.38408135029752755No Hit
CCCCTGGTGGTCTAGTGGTTAGGATTCGGC355030.3659110229059496No Hit
TTTGGTGGTTCAGTGGTAGAATTCTCG325290.3352595460695613No Hit
CCCTGGTGGTCTAGTGGTTAGGATTCG294380.3034022108640212No Hit
CCGTGATCGTATAGTGGTTAGTACTCTG283330.2920135484886987No Hit
ATGTACACGGAGTCGACCCGCAACGCG258070.26597937549316514No Hit
AGCAGAGTGGCGCAGCGGAAGCGTGCTGG252580.2603211169917606No Hit
TGTACACGGAGTCGACCCGCAACGC247280.25485868164432085No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGG245930.2534673066029918No Hit
CCCCTGGTGGTCTAGTGGTTAGGATTCG233440.24059451085025177No Hit
CCCCCTGTGGTCTAGTGGTTAGGATTCGG222760.22958718830107128No Hit
TTGATCGTATAGTGGTTAGTACTCTG202050.20824246451890577No Hit
TGGTGGTCTAGTGGTTAGGATTCGG167310.1724377467887064No Hit
GCAGCAACCTCGGTTCGGATCCGAGTCACGG166090.1711803560106165No Hit
CCCCTGTGGTCTAGTGGTTAGGATTCGG166020.17110821063810314No Hit
TTGGTGGTCTAGTGGTTAGGATTCGG150500.15511255090371356No Hit
TGATCGTATAGTGGTTAGTACTCTG146950.15145374986910767No Hit
ATGTACACGGAGTCGACCGCAACGC145540.15000053593705295No Hit
CCTGGTGGTCTAGTGGTTAGGATTCGGC143030.14741360900835979No Hit
CTAAACCATTCGTATGCCGTCTTCTGCTT136170.14034336250205098Illumina PCR Primer Index 1 (95% over 21bp)
ATGTACACGGAGTCGACCCGCAACGT128780.1327268724609982No Hit
CCGCGGCCCGGGTTCGTTTCCCGGTCAGG123160.12693462969635455No Hit
CGTGATCGTATAGTGGTTAGTACTCTG112970.11643232475476759No Hit
TTGGGTGGTTCAGTGGTAGAATTCTCG109060.11240249037580731No Hit
ATGTACACGGAGGCGACCCGCAACGC108630.11195931165893956No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGGC108370.11169134313246137No Hit
GCAGCAACCTCGGTTCGAATCCGAGTCACGG106550.10981556344711414No Hit
CGCAGCAACCTCGGTTCGTATCCGAGTCACGG103790.10697097447373043No Hit
ATGTACACGGAGCCGACCCGCAACGC100600.10368320678347895No Hit
AGCAGAGTTGCGCAGCGGAAGCGTGCTGG97450.10043666502037797No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ACTCGGC19650.0472.1786827
ACTACGC8350.0340.6904627
CGCTAGC5700.0253.9518126
CGATCAC3950.0210.5181627
CTCGAAG50550.0195.6682627
ACCGGTC8600.0192.0792826
GATCGCC8400.0171.9363627
TACTCGG24400.0166.8074226
CGATCGC41200.0162.5276627
GCTAGCT17200.0155.2152727
GCACCCC12750.0140.7365127
CGATAGC5100.0130.227226
CAATCGC3100.0127.0614727
ACGACCT10850.0119.2864526
CGCACCC14800.0113.9149626
TCCCACC19700.0110.64989526
GTCGGGC13450.0110.63428527
GACTACG10700.0109.81776426
GTACTCG19100.0109.6234925
CAAGGCG8000.0109.41405527