FastQCFastQC Report
Mon 3 Apr 2017
fastq1_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq1_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences26957617
Sequences flagged as poor quality0
Sequence length50
%GC51

[OK]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TCTGCTGTGTTTGGGACTGACCCTAGTCTGAGATCGGAAGAGCACACGTC1075410.3989262107255252No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGAGATCGGAAGAGCACACGTC499010.1851090918014007No Hit
ACTTTTTCTGGAGCAAATCCATGTCTTGAGATCGGAAGAGCACACGTCTG480810.17835775320941757Illumina Multiplexing PCR Primer 2.01 (100% over 22bp)
TTTGCTGACAAAACAGAAAAGGCTGGTGAGATCGGAAGAGCACACGTCTG434840.1613050589746119Illumina Multiplexing PCR Primer 2.01 (100% over 22bp)
AAAAAGGATGGGGAAACCTTCCAGCTGATGAGATCGGAAGAGCACACGTC420000.15580012135345642No Hit
GCGCAGCGGAAGCGTGCTGGGCCAGATCGGAAGAGCACACGTCTGAACTC397250.14736094811347752Illumina Multiplexing PCR Primer 2.01 (100% over 27bp)
TATTCTGTGACGTATGATGGATTCAATACAAGATCGGAAGAGCACACGTC396950.14724966231251077No Hit
ATCACAAGAAAGACGTGGTCCTGACAGAGATCGGAAGAGCACACGTCTGA339770.12603858864824735Illumina Multiplexing PCR Primer 2.01 (100% over 23bp)
TTGTCCATGCAGAAGAAGCTAGTTCTACGAGATCGGAAGAGCACACGTCT319400.11848228276260472Illumina Multiplexing PCR Primer 2.01 (100% over 21bp)
ACTGACCCTAGTCTGTGTCCATGCAGAAGAGATCGGAAGAGCACACGTCT291580.10816237948628768Illumina Multiplexing PCR Primer 2.01 (100% over 21bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TAAGCAC38600.037.642021
TTTAGTT25800.036.3501471
GGCTAGC162250.034.9186485
GCTAGCT164750.034.5356146
CCGGCTA167600.034.145513
TCTCGTA28700.034.03341342
CTAGCTC168850.034.031717
CGGCTAG167450.033.834474
TCGTATG29250.033.46843344
CCCGGCT174300.033.3035352
GTTGCGC29500.033.0364537
AAATCGC13450.032.7358781
TAGCTCA216550.032.4267588
GTCGGTA214400.031.97218115
TAAGCTC20600.031.9536361
TAGGCTG33150.031.8767491
CTCGTAT30700.031.81601743
AGTCGGT215850.031.80836514
GCCCGGC178700.031.6979771
TAACCGC33300.031.5348261