FastQCFastQC Report
Tue 13 Dec 2016
fastq1_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq1_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences109881717
Sequences flagged as poor quality0
Sequence length101
%GC39

[FAIL]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[FAIL]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGTACACGGAGTCGACCCAACGCGACTGTAGGCACCATCAATACGACTA19029031.731773994758382No Hit
ATGTACACGGAGTCGAGCTCAACCCGCAACGCGACTGTAGGCACCATCAA9805490.8923677448542235No Hit
TCCTTAGGTCGCTGGTTCGTTTCCGGCTCGAAGGACTGTAGGCACCATCA1977800.17999354706115486No Hit
ACGGAGTCGAGCTCAACCCGCAACGCGACTGTAGGCACCATCAATACGAC1688550.15366978657605068No Hit
TGTACACGGAGTCGAGCTCAACCCGCAACGCGACTGTAGGCACCATCAAT1396720.12711122815818396No Hit
CTGTAGGCACCATCAATACGACTATCTCGTATGCCGTCTTCTGCTTGAAA1360060.12377491334613927Illumina PCR Primer Index 1 (96% over 27bp)

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ATGTACA10886300.087.427721
TGTACAC11511750.082.646322
GTACACG11529250.082.559983
TACACGG12546400.076.548374
TAGGTCG402800.073.099955
CTTAGGT413600.071.427783
ACACGGA13447500.071.343625
TTAGGTC419750.070.2801744
TCCTTAG431550.069.455131
CACGGAG13792050.069.426966
CCTTAGG445600.066.60442
TATGTAC298950.066.099981
ACGGAGT15000900.063.769757
TTACACG179000.063.434363
TCGCCGC571900.062.6339721
CGGAGTC15255800.062.3970538
TCTTGCG767600.062.103051
TCGGAGT142050.061.7908441
GGAGTCG15443450.061.580959
CTTGCGA775750.061.241742