FastQCFastQC Report
Mon 3 Apr 2017
fastq1_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq1_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences73424558
Sequences flagged as poor quality0
Sequence length100-101
%GC39

[FAIL]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[FAIL]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
CTGTAGGCACCATCAATCAGCATATCTCGTATGCCGTCTTCTGCTTGAAA859746811.709254007358137RNA PCR Primer, Index 10 (96% over 29bp)
CTGTAGGCACCATCAATATCAGTATCTCGTATGCCGTCTTCTGCTTGAAA25773863.5102506166942127RNA PCR Primer, Index 40 (96% over 29bp)
GTCTAGTGGTTAGGATTCGGCGCTGTAGGCACCATCAATCAGCATATCTC844260.11498332751284658No Hit
TACACGGAGTCGACCCAACGCGACTGTAGGCACCATCAATATCAGTATCT801580.10917055843904433No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ATGTACA1006600.072.1441041
GTACACG1021900.070.660333
TGTACAC1061150.068.26632
GTCTAGC485150.061.702451
TCTAGCG490400.061.285422
CTAGCGG499550.060.142663
TACACGG1235900.058.2118644
TCAGACG172400.057.9860652
TCTAGGG168700.056.579382
GTCTAGG172050.055.5697331
CGGTTAG545800.054.9273577
TAGCGGT568900.052.94484
ACGTGTG190300.051.980956
GACGTGT190500.051.9678575
TTAAGGC90400.051.6186871
GCGGTTA582700.051.59396
CAGACGT198300.050.2476463
TCGCCGC254850.050.2035981
AGCGGTT605600.049.906565
ACACGGA1418150.049.2577675