FastQCFastQC Report
Fri 7 Jul 2017
fastq1_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq1_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences310743280
Sequences flagged as poor quality0
Sequence length51
%GC52

[OK]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGCGGTCCGGATCGTATGGGTTATCAATTTGGAATTCTCGGGTGCCAAGGA3472590.11175108919491356RNA PCR Primer, Index 1 (100% over 22bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCGGTCC524450.040.4479062
GGGTTAT653250.038.01491518
TAGGTCC72550.038.0026322
TGCGGTC565550.037.4878431
GGTCCGG741500.037.348554
CGGTCCG674500.036.5250243
TAATTAA195900.036.230526
ATAGGTC78600.035.202931
TTAATTA210000.033.9608885
TGGGTTA814400.033.60595717
TATTAGT207900.033.3934723
TATGGGT700700.031.37304315
TCAGTAG422450.031.29154620
CCCAAGT664050.029.2082481
CTAGCGT195300.028.96956816
GGTTATC872150.028.73973519
TTCAGTA478700.028.60087619
TCTATTA253350.028.4795191
GTATGGG758150.028.26570514
GGGTTCG272300.028.25773