FastQCFastQC Report
Mon 3 Apr 2017
fastq1_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq1_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences203709536
Sequences flagged as poor quality0
Sequence length35-50
%GC37

[FAIL]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CTGTAGGCACCATCAATTCGTATGCCGTCTTCTGCTTGAA8813250.43263806756694984Illumina Single End Adapter 1 (95% over 22bp)
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA2678800.13150096223281368No Hit
TCGACTGCATAATTTGTGGTAGTGGGGGAAAAAAAAAAAAAAAAAAA2472510.12137428853600649No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GTACACG917250.033.474513
ATGTACA1072000.032.8546831
TTGGGGA2255400.031.9272981
TGTACAC1105300.031.8283422
TTGGGGG1518700.031.2150921
GTCTAGC3361600.029.5143641
TCTAGCG3382800.029.3873252
TACACGG1060350.029.1220384
CTAGCGG3416850.029.0990123
CGGTTAG3495150.028.4021177
CGTTGGT390750.028.1426852
GCGTTGG394900.027.8504681
ACGGAGT1082900.027.8093347
TCTAGGG2244950.027.8073392
TCGACGT124450.027.8069461
CTAGGGG2260350.027.641473
TAGGGGT2235900.027.5727584
TCGCGTC185250.027.3785021
GTCTAGG2286500.027.319441
AGCGGTT3649350.027.244595