FastQCFastQC Report
Mon 27 Aug 2018
ribo.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenameribo.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences77988885
Sequences flagged as poor quality0
Sequence length25-44
%GC63

[FAIL]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TCTCCCGGGGCTACGCCTGTCTGAGCGTCGCT67238698.62157344601093No Hit
TCCTCCCGGGGCTACGCCTGTCTGAGCGTCGCT63855978.187829586228858No Hit
CCTCCCGGGGCTACGCCTGTCTGAGCGTCGCT34620944.439214639368162No Hit
CTCCCGGGGCTACGCCTGTCTGAGCGTCGCT22071162.8300391780187653No Hit
ATGTACACGGAGTCGACCCGCAACGCGA20713882.6560041216129706No Hit
TCTCCCGGGGCTACGCCTGTCTGAGCGTCGCTT9755091.2508308074926318No Hit
TGTGGGGGGGCCGGGCCACCCCTCCCACGGCGCGACC7781490.9977691051744104No Hit
TCGCCCCGGGCGGGTCGCGCCGTCGGGCCCGGGGG6224620.7981419403547056No Hit
TCGGGGCTACGCCTGTCTGAGCGTCGCT6098590.7819819452477107No Hit
TGCGCCCCGGGCGGGTCGCGCCGTCGGGCCCGGGGG5640960.7233030706875729No Hit
TTGGGCGCGCGCCGCGGCTGGACGAGGCGCCGCCGCC5453450.6992599009461412No Hit
CCCTCCCGGGGCTACGCCTGTCTGAGCGTCGCT5038110.6460035939736797No Hit
TCGTGGGGGGCCCAAGTCCTTCTGATCGAGGCCC4807210.6163968109045282No Hit
TCCGCCGAGGGCGCACCACCGGCCCGTCTCGC4189390.5371778298920417No Hit
CGTGGGGGGCCCAAGTCCTTCTGATCGAGGCCC4017420.5151272517872258No Hit
TCCCGGGGCTACGCCTGTCTGAGCGTCGCT3940540.5052694367921787No Hit
TAAACGATGCCGACCGGCGATGCGGCGGCGTTA3705570.47514078448486596No Hit
AAAACGATGCCGACCGGCGATGCGGCGGCGTTA3654900.4686437048048578No Hit
TCGACTGCATAATTTGTGGTAGTGGGGGA3404680.4365596456469406No Hit
TAAACGATGCCGACCGGCGATGCGGCGGCGTT3346940.4291560265286521No Hit
CGTGGGGGGCCCAAGTCCTTCTGATCGAGGCC3286690.4214305666762642No Hit
CCCGGGGCTACGCCTGTCTGAGCGTCGCT3226360.4136948489518731No Hit
TCGTGGGGGGCCCAAGTCCTTCTGATCGAGGCC3165070.4058360367634439No Hit
CCGCCGAGGGCGCACCACCGGCCCGTCTCGC3147600.40359597396475155No Hit
TCGACTGCATAATTTGTGGTAGTGGGGG3054830.39170068914307465No Hit
TCGTGGGGGGGCCGGGCCACCCCTCCCACGGCGCGACC2831180.36302352572421054No Hit
GCGCCCCGGGCGGGTCGCGCCGTCGGGCCCGGGGG2647480.3394688871369298No Hit
GTGGGGGGCCCAAGTCCTTCTGATCGAGGCC2621780.33617354575591124No Hit
TTCCCGGGGCTACGCCTGTCTGAGCGTCGCT2391360.3066283099187788No Hit
GTGGGGGGCCCAAGTCCTTCTGATCGAGGCCC2127880.27284400847633605No Hit
ACTCCCGGGGCTACGCCTGTCTGAGCGTCGCT2044910.2622053129750476No Hit
CCGGGGCTACGCCTGTCTGAGCGTCGCT1883650.2415280074846563No Hit
TGTGGGGGGCCCAAGTCCTTCTGATCGAGGCC1852510.2375351308074221No Hit
TACACGGAGTCGACCCGCAACGCGA1819040.23324349360809557No Hit
ATAAACGATGCCGACCGGCGATGCGGCGGCGTT1817030.2329857645740159No Hit
GTGGGGGGGCCGGGCCACCCCTCCCACGGCGCGACC1810760.23218180385576737No Hit
TTGGGCGCGCGCCGCGGCTGGACGAGGCGCCGCCGC1779960.22823252313454667No Hit
CTCCCGGGGCTACGCCTGTCTGAGCGTCGCTT1730180.2218495622805737No Hit
ACCTCCCGGGGCTACGCCTGTCTGAGCGTCGCT1703490.21842727973351586No Hit
TGTGGGGGGCCCAAGTCCTTCTGATCGAGGCCC1645860.21103776518923176No Hit
TGGGCGCGCGCCGCGGCTGGACGAGGCGCCGCCGCC1624830.2083412270863983No Hit
TCTCGACTGCATAATTTGTGGTAGTGGGGGA1386100.1777304547949365No Hit
TCTCGACTGCATAATTTGTGGTAGTGGGGG1295330.16609161677333892No Hit
CCTCCCGGGGCTACGCCTGTCTGAGCGTCGCTT1269000.16271549465029536No Hit
GCTCCCGGGGCTACGCCTGTCTGAGCGTCGCT1194670.15318464932534936No Hit
TCCTCCCGGGGCTACGCCTGTCTGAGCGTCGCTT1163800.1492263929661259No Hit
TCCCGGGGCTACGCCTGTCTGAGCGTCGCTT1142550.14650164571528365No Hit
GCCTCCCGGGGCTACGCCTGTCTGAGCGTCGCT1115790.14307038753022305No Hit
TAACGATGCCGACCGGCGATGCGGCGGCGTTAT1054150.13516669715178004No Hit
TCCGCCGAGGGCGCACCACCGGCCCGTCTCGCC1040590.1334279878472426No Hit
TTGCGCCCCGGGCGGGTCGCGCCGTCGGGCCCGGGGG952950.1221904890677691No Hit
CTCGACTGCATAATTTGTGGTAGTGGGGG948640.12163784621359826No Hit
AAATTTTTGACAGTCTCTACGGAGACTG920280.11800143058847425No Hit
TTGGGGGGCCCAAGTCCTTCTGATCGAGGCC911670.116897427114133No Hit
TGGGGCTACGCCTGTCTGAGCGTCGCT902620.11573700534377432No Hit
AAACGATGCCGACCGGCGATGCGGCGGCGTTA889550.1140611255052563No Hit
TTCTCCCGGGGCTACGCCTGTCTGAGCGTCGCT849580.10893603620567213No Hit
ACGGGGTCGGCGGCGACGTCGGCTACCC847550.10867574270359166No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCG843280.10812822878542244No Hit
TGTGGGGGGGCCGGGCCACCCCTCCCACGGCGCGACCG839510.10764482656727302No Hit
TGGGCGCGCGCCGCGGCTGGACGAGGCGCCGCCGC830880.10653825862493099No Hit
TCGGGGCTACGCCTGTCTGAGCGTCGCTT824420.10570993546067495No Hit
TTGGGGGGGCCGGGCCACCCCTCCCACGGCGCGACC805720.10331215787993378No Hit
TGGGGGGGCCGGGCCACCCCTCCCACGGCGCGACC789830.101274688053304No Hit
TCCTCCCGGGGCTACGCCTGTCTGAGCGTCGCTGGGA786390.10083359955716767No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GGTGACG28356.891166E-510094.03937
CGAGGTT28607.013236E-510005.80537
AGATTTT61053.1954667E-44687.40437
ACCGCTC31350.03666.204836
CTCCCCG90500.03162.055437
AGAAAAC95307.786172E-43002.791337
GGGAGAG327650.01851.642834
ATAGTAG10000.00301251721641.93636
GCTCGTT10200.00313419831609.741236
GGAGAGA141350.01377.699235
GGAGAGC146600.01259.175935
TTCGGCG234800.01218.764937
ATTAGTC13850.00577779771185.513436
GGGGAGT42100.01185.4234
TGGGAGT145350.01060.190433
TGGGAGA424600.01017.6737733
GGAGAGT58300.0939.451135
TAGGGAG61450.0815.5948533
ACCGGGT20650.0795.1263436
CCGTCAC43554.9609953E-5754.046436