FastQCFastQC Report
Mon 3 Apr 2017
fastq1_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq1_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences270314766
Sequences flagged as poor quality0
Sequence length101
%GC46

[OK]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
ACAGAAAAGGCTGGTGAATATTCTGTGACGAGATCGGAAGAGCACACGTC12590260.4657629394910673No Hit
CATCTCATTAACGAAAAGGATGGGGAAACAGATCGGAAGAGCACACGTCT11847560.43828756287771564Illumina Multiplexing PCR Primer 2.01 (100% over 21bp)
ACGCCCGCGGTCGGCGGGAGAGGCAGATCGGAAGAGCACACGTCTGAACT10925130.40416327090322546Illumina Multiplexing PCR Primer 2.01 (100% over 26bp)
ATCACAAGAAAGACGTGGTCCTGACAGACAAGATCGGAAGAGCACACGTC9854260.36454760299701866No Hit
ATCGTATAGTGGTTAGTACTCTGCAGATCGGAAGAGCACACGTCTGAACT8010740.2963485908868182Illumina Multiplexing PCR Primer 2.01 (100% over 26bp)
ATCACAAGAAAGACGTGGTCCTGACAGACAGATCGGAAGAGCACACGTCT7862580.2908675732497721Illumina Multiplexing PCR Primer 2.01 (100% over 21bp)
TCTGTGACGTATGATGGATTCAATACATTTAGATCGGAAGAGCACACGTC6987000.25847644593710434No Hit
ACGATTAAAGTCCTACGTGATCTGAGTAGATCGGAAGAGCACACGTCTGA6330910.23420511182877815Illumina Multiplexing PCR Primer 2.01 (100% over 23bp)
TGTGAGGAGCATGGAATCCTTAGAGAAAATAGATCGGAAGAGCACACGTC5709020.21119896942662764No Hit
TATTCTGTGACGTATGATGGATTCAATACAGATCGGAAGAGCACACGTCT5619530.20788838446213478Illumina Multiplexing PCR Primer 2.01 (100% over 21bp)
ACTGTAAGAGATGAAGAGTGCTCCGAATTAGATCGGAAGAGCACACGTCT5599190.20713592834214611Illumina Multiplexing PCR Primer 2.01 (100% over 21bp)
ATCACCAGAAAGACGTGGTTCTGACAGGCAAGATCGGAAGAGCACACGTC5514580.2040058736561953No Hit
TGTGAGGAGCATGGAATCCTTAGAGAAAAAGATCGGAAGAGCACACGTCT5399520.19974935442483374Illumina Multiplexing PCR Primer 2.01 (100% over 21bp)
GATCACAAGAAAGACGTGGTCCTGACAGACAGATCGGAAGAGCACACGTC5344530.19771505933937772No Hit
CCTAAGACAGACTATGATAACTTTCTTATGAGATCGGAAGAGCACACGTC5168200.19119192327066586No Hit
AACGATTAAAGTCCTACGTGATCTGAGTAGATCGGAAGAGCACACGTCTG3636770.1345383403879609Illumina Multiplexing PCR Primer 2.01 (100% over 22bp)
ATCGTATAGTGGTTAGTACTCTGCGAGATCGGAAGAGCACACGTCTGAAC3167010.11716008144371957Illumina Multiplexing PCR Primer 2.01 (100% over 25bp)
CACAAGAAAGACGTGGTCCTGACAGACAGAGATCGGAAGAGCACACGTCT3055140.113021572783782Illumina Multiplexing PCR Primer 2.01 (100% over 21bp)
ACGCACGCGCGCGCGCGCGCGCGGACAGATCGGAAGAGCACACGTCTGAA2871730.10623651983554609Illumina Multiplexing PCR Primer 2.01 (100% over 24bp)
TATGGCCGAGAACCAGATTTGAGTTCAGACAGATCGGAAGAGCACACGTC2847910.10535532491036763No Hit
CTCATTAACGAAAAGGATGGGGAAACAGATCGGAAGAGCACACGTCTGAA2821820.10439015381053951Illumina Multiplexing PCR Primer 2.01 (100% over 24bp)
GTGTGTGTCCATGCAGAAGAAGCTAGTTCTAGATCGGAAGAGCACACGTC2756430.10197112206589556No Hit
ATAGAAGATAATGGCAACTTTAGACTTTTAGATCGGAAGAGCACACGTCT2747170.10162855846358021Illumina Multiplexing PCR Primer 2.01 (100% over 21bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TAGGGGT311300.082.188754
GGGGTAT315050.080.946586
ACGCCCG1669500.080.560371
GCGGTCG1665850.079.968967
CGCGGTC1669750.079.7846766
CCGCGGT1678700.079.485915
CGGTCGG1707350.078.000588
CGCCCGC1733150.077.77832
TCTAGGG338000.077.391972
GGCTAGC653200.072.391635
AGGGGTA354950.071.975395
CACGCGC471750.069.732154
CCCGCGG1935950.069.583564
GCTAGCT684000.069.567996
GCCCGCG1954800.068.915463
CTAGGGG391950.066.804643
CGGCTAG719850.066.017164
TTAGTCT382150.065.8365557
CGTATAG1814650.064.921263
GGTCGGC2076850.064.341199