FastQCFastQC Report
Wed 29 Aug 2018
fastq1_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq1_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences18116818
Sequences flagged as poor quality0
Sequence length25-51
%GC51

[FAIL]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGTACACGGAGTCGACCCAACGCGA6571593.627342284942091No Hit
ATGTACACGGAGTCGAGCTCAACCCGCAACGCGA2332531.287494305015373No Hit
TCAGGTATTTCCAAACTCAACTCGGACT320770.1770564786818524No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TCAATAG32300.01191.16145
ATCAATA43850.0738.714344
TAAATCG5650.0491.4177645
ATCGGAA15200.0461.0120545
AATCGGA12850.0390.9853244
TAGTCGG3750.0387.8345
ATAAATC15400.0377.7564745
ATAGTCG3900.0372.9134844
TAATCGG7250.0364.7303843
CAATAGA20700.0344.9081443
ACAATAG13400.0335.470345
AAATCGG9400.0309.4388445
TTAATAG7550.0297.7021545
TAAATAG6300.0293.810645
ATAATCG8450.0285.8412842
GCAACGC361300.0276.859726
CTCAATA19700.0261.74544
TAGACGG4600.0258.681145
ATAGAAC13800.0258.681145
AATAGAT15350.0251.7637842