FastQCFastQC Report
Wed 29 Aug 2018
fastq2_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq2_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences5043425
Sequences flagged as poor quality0
Sequence length25-51
%GC55

[FAIL]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGTACACGGAGTCGACCCAACGCGA54737810.853299097339605No Hit
ATGTACACGGAGTCGAGCTCAACCCGCAACGCGA3568777.076084208647893No Hit
TACACGGAGTCGAGCTCAACCCGCAACGCGA212250.4208449615092918No Hit
TCAGGTATTTCCAAACTCAACTCGGACT203300.40309908445153836No Hit
TGTACACGGAGTCGACCCAACGCGA147890.2932332690582293No Hit
TTGCGTTGATTAAGCTACACTGACTGGCTCAGCG144890.28728493037965275No Hit
TGTACACGGAGTCGAGCTCAACCCGCAACGCGA132300.2623217357252264No Hit
ACGGAGTCGAGCTCAACCCGCAACGCGA119790.23751716343556215No Hit
ATGTACACGGAGTCGAGCTCAACCCGCAACGCG108270.21467554290982815No Hit
TATGTACACGGAGTCGACCCAACGCGA103170.20456336715624798No Hit
AACACAAAGCACCCAACTTACACTTAGGAGATT100730.19972538503100573No Hit
ATGTACACGGAGTCGACCCAACGCG88800.17607082488586626No Hit
CACAAAGCACCCAACTTACACTTAGGAGATT74440.14759811041107979No Hit
ACACGGAGTCGAGCTCAACCCGCAACGCGA66820.1324893301674953No Hit
ATGTACACGGAGTCGAGCTCAACCCGCAACG62900.12471683429415527No Hit
ATGTACACGGAGTCGAGCTCAACCCGCAAC52890.1048692109033048No Hit
ATGTACACGGAGTCGAGCTCAACCCGCAA52380.10385799332794678No Hit
TCAAAGCACCCAACTTACACTTAGGAGATT52250.10360023198520846No Hit
ATGTACACGGAGTCGAGCTCAACCCGCAACGC50670.10046744028115814No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TCAATAG27300.0478.1666645
TAAATAG2900.0331.3184845
TCGATAG850.0311.8291645
ATCATAG4950.0281.1187445
ATCGGAA5800.0279.90745
TTAATAG2450.0270.4640845
ATCAATA38600.0268.659844
ACAATAG4200.0268.2102445
CAAATAG2100.0268.2102445
TAGATCG3050.0249.8467344
ATAATAG4450.0245.6968845
CTCAATA10050.0237.3625244
CATAATA4350.0236.1120344
ATAGATC3550.0223.9899743
AATCGGA4400.0218.3690245
TAGATTG1007.094059E-11198.791144
TAGTCGG1350.0196.336945
CATATAG1201.8189894E-12193.2691245
TAGAACG1550.0192.3784844
GTCAATA2550.0181.9003444