FastQCFastQC Report
Wed 29 Aug 2018
fastq1_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq1_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences37165598
Sequences flagged as poor quality0
Sequence length25-51
%GC51

[FAIL]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[WARN]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGTACACGGAGTCGACCCAACGCGA17601264.735901195508815No Hit
ATGTACACGGAGTCGAGCTCAACCCGCAACGCGA13497553.631732227206461No Hit
CAGGTATTTCCAAACTCAACTCGGACT730280.19649354222687335No Hit
AACACAAAGCACCCAACTTACACTTAGGAGATT681560.18338464512262118No Hit
TGCGTTGATTAAGCTACACTGACTGGCTCAGCG430270.11577104181130088No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TCAATAG66700.0845.887545
TAAATAG16500.0453.711645
ATAAATC46550.0437.3560845
ATCAATA110800.0425.1216744
AAATCGG25650.0405.7583345
TAAATCG19450.0389.5905845
AATCGGA20850.0363.3919744
ATCGGAA28200.0362.5925645
ATTCTGT66800.0345.084231
GGATTCT91600.0298.0829
TTCTGTA78750.0295.268132
ACAATAG23050.0285.1750545
TCCATAG15650.0280.0121545
TAGATCG10950.0275.107944
CATAAAT49450.0271.365344
CTCAATA50850.0260.303744
CAATAAA88600.0254.4875344
AATAAAT76650.0251.3160745
TCTGTAG101300.0250.7811633
CCATAAA58900.0249.6590643