FastQCFastQC Report
Wed 29 Aug 2018
fastq2_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq2_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences1971938
Sequences flagged as poor quality0
Sequence length25-51
%GC52

[FAIL]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[WARN]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGTACACGGAGTCGACCCAACGCGA410892.083686201087458No Hit
ATGTACACGGAGTCGAGCTCAACCCGCAACGCGA374881.901073968857033No Hit
TTGCGTTGATTAAGCTACACTGACTGGCTCAGCG212281.0765044337093763No Hit
AACACAAAGCACCCAACTTACACTTAGGAGATT193520.9813695968128816No Hit
CTTCAGCTCGCCATGGATCCCAACTGCT81430.41294401750967835No Hit
CACAAAGCACCCAACTTACACTTAGGAGATT76000.3854076548045628No Hit
ATTCCCCATGAACGTACACTGACTGGCTCAGCG65270.33099417933018177No Hit
TCAGGTATTTCCAAACTCAACTCGGACT64930.3292699871902666No Hit
TGCGTTGATTAAGCTACACTGACTGGCTCAGCG59980.3041677780944432No Hit
CACAAAGCACCCAACTTACACTTAGGAGAT44130.223789997454281No Hit
GCAGCTAACGCATTAAATGATCCGCCTGAGT43490.22054445930855837No Hit
CTGCGTTGATTAAGCTACACTGACTGGCTCAGCG39300.19929632676078052No Hit
ATTCCCCATGAACGACTACACTGACTGGCTCAGCG36690.1860606165102554No Hit
GAATGGGTGAGTAACACGTGCTTAATCTACCCTT34700.1759690213383991No Hit
ACAAAGCACCCAACTTACACTTAGGAGATT34350.17419411766495702No Hit
TTGCGTTGATTAAGGCTACACTGACTGGCTCAGCG33870.17175996405566504No Hit
TATTCCCCATGAACGCTACACTGACTGGCTCAGCG29100.14757056256332604No Hit
AACACAAAGCACCCAACTTACACTTAGGAGAT27830.14113019780540767No Hit
TTTGCGTTGATTAAGCTACACTGACTGGCTCAGCG25140.12748879528666723No Hit
CAAAGCACCCAACTTACACTTAGGAGATT24670.12510535321090216No Hit
ATTCCCCATGAACTACACTGACTGGCTCAGCG23310.11820858465124158No Hit
GCAGCAGTAGGGAATATTCCACAATGAGCG23200.11765075778244549No Hit
TCTTCAGCTCGCCATGGATCCCAACTGCT22530.11425308503614212No Hit
ACACAAAGCACCCAACTTACACTTAGGAGATT19910.10096666325209007No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TCAATAG18500.0279.2370645
ACAATAG2950.0241.9767845
TTAATAG2000.0234.81345
ATCATAG3650.0231.5963745
TCCATAG2000.0187.850445
ATAATAG2500.0187.850445
CAAATAG1400.0187.850445
TCGATAG304.374469E-5187.8503945
ATCGGAA2600.0180.625445
CTTAATA900.0166.7898344
TAAATCG1600.0164.369145
CCAATAG1950.0163.7670145
CATCATA5050.0159.7714244
TAAATAG2000.0159.6728445
ATCAATA26400.0157.7869644
CATAATA3000.0156.3654544
GATCGGA1600.0140.8877945
ATATATC951.6370905E-11138.4160945
ATAAATA4150.0135.7954645
CTCAATA8850.0131.4529944