FastQCFastQC Report
Mon 3 Apr 2017
fastq1_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq1_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences22568384
Sequences flagged as poor quality0
Sequence length51
%GC48

[OK]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CTGTAGGCACCATCAATTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAAA1342760.5949739245840553Illumina Single End Adapter 1 (95% over 22bp)
ATGTACACGGAGTCGAGCACCCGCAACGCGACTGCTGTAGGCACCATCAAT1097830.4864459945382No Hit
TAGTCACTTAGCGATGTACACTGACTGTGCTGTAGGCACCATCAATTCGTA321140.1422964089941043No Hit
AACGATTAAAGTCCTACGTGATCTGAGTTCCTGTAGGCACCATCAATTCGT243260.10778795681604851No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TAGTCAC177550.039.2398071
GTATTAG67350.039.2035317
TATTAGA69400.038.1173718
GTACACG200400.037.8421173
ACCTAAT36050.037.7792361
GTCGGTT85900.037.2270743
TACGATT81850.037.20925520
AGTATTA72150.037.06225616
CTAGCAT71200.036.8372885
ACGATTT83150.036.4103921
CGGTTTC88050.036.342125
CTATCTA87650.036.1958811
ATTTACG86100.036.19443517
TATTTAC88550.036.1819416
TCGGTTT89000.036.1312184
CTCTAGC73100.036.127013
CCTCTAG72850.035.914372
AGGTCGG82600.035.8336871
TCTAGCA74050.035.6321754
GGTCGGT89500.035.6317562