FastQCFastQC Report
Mon 3 Apr 2017
fastq1_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq1_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences176931039
Sequences flagged as poor quality0
Sequence length40-51
%GC38

[FAIL]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[WARN]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
GCCCGGATAGCTCAGTCGGTAGAGCATCAGAAAAAAAAAA50536352.8562738502880776No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGAAAAAAAAAA37502202.1195941770284863No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACAAAAAAAA21418651.2105648687226667No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAAAAAAAAAAAA20922621.1825296521318682No Hit
GCCCGGATAGCTCAGTCGGTAGAGCATCAGACAAAAAAAA19552371.1050842243683427No Hit
GCCCGGATAGCTCAGTCGGTAGAGCATCAAAAAAAAAAAA18915981.0691159734838838No Hit
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA15966260.9024001718545269No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGGGAAAAAAAAAA11889050.6719595423841941No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACAAAAAAAAAAAAAAAAAAA11179370.6318489996546056No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCAAAAAAAAAAAAAAA10135800.57286726270793No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGGGACAAAAAAAA9694180.5479072555494348No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCACGAAAAAAAAAAAA8393140.4743735213130128No Hit
AGCAGAGTGGCGCAGCGGAAGCGTGCTGGGCAAAAAAAAA8262410.4669847668729284No Hit
GCCCGGATAGCTCAGTCGGTAGAGCATCAGAAAAAAAAAAAAAAAAAAAAA7451580.4211573075089442No Hit
GCCCGGATAGCTCAGTCGGTAGAGCATCAGACAAAAAAAAAAAAAAAAAAA7375440.41685393595637No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGACAAAAAAAAAA7312030.41327005376371523No Hit
GCCCGGATAGCTCAGTCGGTAGAGCATCAGTAAAAAAAAA5801040.32787011441220326No Hit
GCCCGGATAGCTCAGTCGGTAGAGCATCAGGAAAAAAAAA5482010.30983879544165227No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGTAAAAAAAAA5333060.3014202612578339No Hit
GCCCGGATAGCTCAGTCGGTAGAGCATCAGAAAAAAAAAAAAAAAAAAAAG5209110.294414706963881No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGAAAAAAAAAAAAAAAAAAAAA5162630.29178769475264316No Hit
TGCCCGGATAGCTCAGTCGGTAGAGCATCAGAAAAAAAAA4901360.2770209245196373No Hit
TAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA4619250.26107629425043954No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGGAAAAAAAAA4617040.2609513868281755No Hit
GCCCGGATAGCTCAGTCGGTAGAGCACCAAAAAAAAAAAA4569120.25824298697528136No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGAAAAAAAAAAAAAAAAAAAAG4388170.24801583853243525No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGATAAAAAAAA4329940.24472472577296064No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGGGACAAAAAAAAAAAAAAAAAAA4303750.24324448804033758No Hit
GCCCGGATAGCTCAGTCGGTAGAGCATCACAAAAAAAAAA4226690.23888911882781627No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATAAAAAAAAAAAAA4098520.2316450535284541No Hit
GCCCGGATAGCTCAGTCGGTAGAGCATCAGAAAAAAAAAAAAAAAAAAAAT4071530.23011960043935534No Hit
TGCCCGGCTAGCTCAGTCGGTAGAGCATGAGAAAAAAAAA3825690.21622492139437444No Hit
GCCTGGATAGCTCAGTCGGTAGAGCATCAGAAAAAAAAAA3783780.213856201907004No Hit
AGCAGAGTTGCGCAGCGGAAGCGTGCTGGGCAAAAAAAAA3759780.21249974121273318No Hit
GTATAGTGGTGAGTATCCCCGCAAAAAAAAAAAAAAAAAA3490790.19729664278973685No Hit
GCCCGGATAGCTCAGTCGGTAGAGCATCAGCAAAAAAAAA3225760.18231736038129523No Hit
TCCTTAGGTCGCTGGTTCGTTTCCGGCTCGAAGGACCAAA2984610.16868775636365307No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGAAAAAAAAAAAAAAAAAAAAT2981930.1685362849194595No Hit
ATAGCTCAGTCGGTAGAGCATCAGAAAAAAAAAAAAAAAA2973510.16806039329255282No Hit
AGCAGAGTGGCGCAGCGGAAGCGTGCTGGGCAAAAAAAAAAAAAAAAAAAA2780640.1571595360382188No Hit
TCCTCGTTAGTATAGTGGTGAGTATCCCCGCAAAAAAAAA2776550.15692837252823683No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTAAAAAAA2677860.15135049311500398No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGGCAAAAAAAA2674860.15118093552822012No Hit
GCCCGGATAGCTCAGTCGGTAGAGCATCAGAAANAAAAAA2652260.14990360170778175No Hit
GTGTAATGGTTAGCACTCTGGACTAAAAAAAAAAAAAAAA2466370.1393972484386982No Hit
GCGCAGCGGAAGCGTGCTGGGCAAAAAAAAAAAAAAAAAA2423430.1369703141798653No Hit
TGCCCGGCTAGCTCAGTCGGTAGAGCATGAAAAAAAAAAA2379400.13448177399783426No Hit
ATCAGAGTGGCGCAGCGGAAGCGTGCTGGGCAAAAAAAAA2359410.13335195527789784No Hit
TGCCCGGATAGCTCAGTCGGTAGAGCATCAAAAAAAAAAA2221310.1255466543662811No Hit
TGCCCGGCTAGCTCAGTCGGTAGAGCATGAGACAAAAAAA2216260.12526123242852827No Hit
ATAGCTCAGTCGGTAGAGCATCAGACAAAAAAAAAAAAAA2194730.12404437414737614No Hit
TTATAACCTAGACTTACAAGTCAAAGTAAAAAAAAAAAAA2159440.12204981173484207No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCAAAAAAAAAA2147350.12136649466010314No Hit
CAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA2104130.11892373502650373No Hit
GCCCGGATAGCTCAGTCGGTAGAGCATCATAAAAAAAAAA2089230.11808159901214392No Hit
GCCTGGATAGCTCAGTCGGTAGAGCATCAGACAAAAAAAA2087150.11796403908530713No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCAAAAAAAA2064640.11669179199247227No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGAAANAAAAAA2012970.11377144515609837No Hit
GCCCGGATAGCTCAGTCGGTAGAGCATCAGGCAAAAAAAA1907230.10779510541392345No Hit
GCCCGGATAGCTCAGTCGGTAGAGCATCAGATAAAAAAAA1823860.10308310007720015No Hit
TCAGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA1801470.10181763528783663No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GGAACCC89300.037.8053542
TGCCCGG4667250.037.1390531
CGGGATA716150.037.0929763
GGGATAG724850.037.0170334
GGGCTAG751750.036.9985774
CCTCGTT1202150.036.9431952
CCGGGAT670650.036.9074552
CGGGCTA755600.036.6795773
GCGTTGG590850.036.6740231
CGTTAGT1254500.036.50045
TCAGAGT1345500.036.30212
CTCGTTA1228200.036.129393
CCGGGCT705900.036.066982
CTGGATA1368050.035.7844123
ATCAGAG1375800.035.747991
CCTGGAT1343150.035.6334232
GGAAATT432100.035.499345
GCCTGGA1352500.035.0719071
ATATCTC1024450.035.0040361
GCAGAGT4116150.034.845392