FastQCFastQC Report
Mon 3 Apr 2017
fastq2_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq2_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences5210882
Sequences flagged as poor quality0
Sequence length26-48
%GC55

[OK]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[WARN]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGTACACGGAGTCGACCCGCAACGC1018961.9554463140788834No Hit
ATGTACACGGAGTCGACCCGCAACGCG754701.448315275609772No Hit
AAAAAGGGACAAGCATCAAGCACGCAGC553971.0631021773281375No Hit
AAAAGGGACAAGCATCAAGCACGCAGC468490.8990608499674335No Hit
CCTCGCCCGTCACGCACCGCACGTTC218070.41848961461802436No Hit
AGGTCGGTTTCTATCTACTTCAAATTCC182340.34992156798023827No Hit
ATGTACACGGAGTCGACCCGCAACGCC122830.23571825268735697No Hit
AAAAGGGACAAGCATCAAGCACGCAAC107390.20608795209716896No Hit
CCTCGCCCGTCACGCACCGCACGTTCG100390.19265452566379357No Hit
TCCTCGCCCGTCACGCACCGCACGTTC96130.1844793261486251No Hit
CTAAACCATTCGTATGCCGTCTTCTGCTTG91750.17607383932317025Illumina PCR Primer Index 1 (95% over 22bp)
AAAAAGGGACAAGCATCAAGCACGCAAC85650.16436756771694314No Hit
CTCGCCCGTCACGCACCGCACGTTCGTGGGG85160.16342722786660685No Hit
CAAAAGGGACAAGCATCAAGCACGCAGC84810.1627555565449381No Hit
TCGGCGGGGCGCGGGACATGTGGCGTACG72100.13836429226376648No Hit
AATAAGGCCTACTTCACAAAGCGCCTTCCC71350.13692499657447624No Hit
TCGGCGGGGCGCGGGACATGTGGCGTAC70420.1351402699197564No Hit
ATGTACACGGAGTCGACCCGCAACGTG70070.1344685985980876No Hit
CTCGCCCGTCACGCACCGCACGTTCG67580.1296901369096441No Hit
ATGTACACGGAGTCGACCCGCAACGCT67070.1287114158409267No Hit
TCGCCCGTCACGCACCGCACGTTCGTGGGG65940.12654287700239614No Hit
ATGCAGCTCAAAACGCTTAGCCTAGCCACAC58610.11247616046573307No Hit
AAAGGGACAAGCATCAAGCACGCAGC58500.11226506376463717No Hit
TCAAAAGGGACAAGCATCAAGCACGCAGC56030.1075249832945747No Hit
ATCACCTCTAGCATCACCAGTATTAGAGGC54630.10483829800789964No Hit
AGGTCGGTTTCTATCTACTTCAAATTCCT53390.10245866246827312No Hit
AGGTCGGTTTCTATCTACTTCAAATTCCTCC53240.10217080333041507No Hit
AGAAATAAGGCCTACTTCACAAAGCGCCTTCC52130.10004064571026555No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GAATAGT505.026829E-43999.710736
ACCCCCC2700.03303.064542
CCCCCCC17950.03063.845241
CCCCCCA3350.02662.171442
ACACCCC3701.6370905E-111505.193833
CAAAACA6101.02209015E-81462.012242
ACCACCC4351.36478775E-81379.210736
CCACCCC7502.5465852E-111333.236941
AAACCAC5153.8198777E-111256.334134
AACCACC5854.1836756E-111232.92235
CCCCCAC4402.1855158E-81229.419335
ACAACCC2100.00645227541114.407840
AACCCCC3054.444155E-81040.27832
CACCCCC9106.5847416E-10980.030142
CACAAAC2400.008793025954.792239
CCCAAAA4951.3042154E-9945.5581740
ACCCAAA4852.4258317E-5944.9488539
CCCCCAA4108.278512E-7879.5845335
CAAAAAA6350.0864.535329
CCAACCC4653.2423508E-5860.1528336