FastQCFastQC Report
Mon 27 Aug 2018
ribo.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenameribo.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences27300678
Sequences flagged as poor quality0
Sequence length25-44
%GC61

[FAIL]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
CTCCCGGGGCTACGCCTGTCTGAGCGTCGCT287891610.545217961253563No Hit
CCTCCCGGGGCTACGCCTGTCTGAGCGTCGCT22836078.364653068323065No Hit
TCTCCCGGGGCTACGCCTGTCTGAGCGTCGCT6339452.3220851877744577No Hit
TCGACTGCATAATTTGTGGTAGTGGGGG3232531.1840475170616642No Hit
TCCCGGGGCTACGCCTGTCTGAGCGTCGCT2575130.9432476365605279No Hit
CCCGGGGCTACGCCTGTCTGAGCGTCGCT2262280.8286534129298914No Hit
GTGGGGGGGCCGGGCCACCCCTCCCACGGCGCGACC2137910.7830977677550718No Hit
TCCTCCCGGGGCTACGCCTGTCTGAGCGTCGCT2012390.7371208876204466No Hit
CCGCCGAGGGCGCACCACCGGCCCGTCTCGC1955780.7163851388599213No Hit
GCGCCCCGGGCGGGTCGCGCCGTCGGGCCCGGGGG1856790.6801259661023803No Hit
CTCCCGGGGCTACGCCTGTCTGAGCGTCGCTT1830730.6705804156219124No Hit
ACGGGCCCCTCTCTCGGGGCGAACCC1361560.4987275407592442No Hit
GTGGGGGGCCCAAGTCCTTCTGATCGAGGCC1292860.47356333055171745No Hit
TCGCCCCGGGCGGGTCGCGCCGTCGGGCCCGGGGG1182970.43331158295775657No Hit
TCGACTGCATAATTTGTGGTAGTGGGGGA1148080.4205316805685192No Hit
AAACGATGCCGACCGGCGATGCGGCGGCGTTA1139390.41734860943746527No Hit
ATAAACGATGCCGACCGGCGATGCGGCGGCGTT995930.36480046392987014No Hit
CTCGACTGCATAATTTGTGGTAGTGGGGG876430.32102865723701074No Hit
ACGGGGTCGGCGGCGACGTCGGCTACCC870320.3187906175809993No Hit
AAACGATGCCGACCGGCGATGCGGCGGCGTT847970.3106040077099917No Hit
ACTGGCAATTTTTGACAGTCTCTACGGAGACTG828900.30361883320260397No Hit
ACTGGACGCCTCGCGGCGCCCATCTCCGCC686290.2513820352739957No Hit
CGTGGGGGGCCCAAGTCCTTCTGATCGAGGCC656270.24038597136671844No Hit
TCTCGCTTCTGGCGCCAAGCGCCCGGCCG646840.2369318446963112No Hit
TCGACTGCATAATTTGTGGTAGTAGGGG642230.2352432419443942No Hit
AAGCTTGGGCTGCAGGTCGACCCGTGC640200.2344996706675197No Hit
AACGGGTTACCCGCGCCTGCCGGCGTAGGGTAGGC610690.22369041530763445No Hit
TTGGCAATTTTTGACAGTCTCTACGGAGACTG601670.22038646805767975No Hit
ACGCATCCCCCCCGCGAAGGGGGTC595120.2179872602431339No Hit
CGCCCCGGGCGGGTCGCGCCGTCGGGCCCGGGGG588730.21564665903169145No Hit
TCCCGGGGCTACGCCTGTCTGAGCGTCGCTT587450.21517780620686414No Hit
TCCGCCGAGGGCGCACCACCGGCCCGTCTCGC565430.20711207245475735No Hit
TCGACTGCATAATTTGTGGTAGTGGGG482220.17663297592829014No Hit
AAACCCTTGTGTCGAGGGCTGACTTTC479540.175651315326308No Hit
TGGGGGGGCCGGGCCACCCCTCCCACGGCGCGACC464810.17025584492810034No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCG425290.15578001396155802No Hit
ACCGGACGCCGCCGGAACCGCGACGCTTTCC408050.14946515247716557No Hit
AAGCGAGCTTTTGCCCTTCTGCTCC406970.14906955790621756No Hit
GTGGGGGGGCCGGGCCACCCCTCCCACGGCGCGA395060.14470702888770748No Hit
CTGGCAATTTTTGACAGTCTCTACGGAGACTG370460.13569626366055818No Hit
TCTCCCGGGGCTACGCCTGTCTGAGCGTCGCTT369670.13540689355773508No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGG353240.12938872800155365No Hit
CGTGGGGGGCCCAAGTCCTTCTGATCGAGGCCC351260.12866347128814895No Hit
ACGGGCCCCTCTCTCGGGGCGAACCCATTCC347770.12738511475795583No Hit
AAGGCACGGGCCCCTCTCTCGGGGCGAACCC340080.12456833489629818No Hit
GTGGGGGGCCCAAGTCCTTCTGATCGAGGCCC331920.12157939813802426No Hit
CTCGACTGCATAATTTGTGGTAGTGGGGGA331100.12127903929711929No Hit
ACCGGACGCCGCCGGAACCGCGACGCTTTCCAAGGC326910.11974427887834872No Hit
ACTCTCGACTGCCGGCGACGGCCGGGT316040.11576269278001082No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGGGA288760.10577026695087939No Hit
TGGGCGCGCGCCGCGGCTGGACGAGGCGCCGCCG288020.10549921141152611No Hit
TGGGCGCGCGCCGCGGCTGGACGAGGCGCCGCCGC287480.1053014141260521No Hit
AAAACGATGCCGACCGGCGATGCGGCGGCGTTA286720.1050230327613109No Hit
TAAACGATGCCGACCGGCGATGCGGCGGCGTT280510.1027483639783598No Hit
ACGGGGTCGGCGGCGACGTCGGCTACCCACCC278940.1021732866854076No Hit
CTCCCGGGGCTACGCCTGTCTGAGCGTCGC274590.10057991966353363No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TAGCTTA2901.6799666E-521054.3937
CGCACTT10450.05842.845737
TTGCGCC19550.04907.81936
AATGGCG15404.7369368E-43964.787637
CCGTGTT16100.03792.405837
ATTGCGC9250.03403.556235
TTCAATG23850.0011360572560.072837
TCAACGC27500.02220.28137
CCAAACC29600.02062.761237
GAACAAA30200.00182143052021.779337
ATAGCTT5700.00230385571870.328736
TTAGGAC12600.01627.353632
CATTGCG7200.01425.976734
CTCGCGC32050.01309.740735
CGAACAA8600.00524356031239.636536
AACTCTC17300.01232.47136
GATGAGG56450.0063624571081.62537
GTCAGAC11350.00913164939.28436
TCCCGTC41800.0870.387131
GGAAGAC62900.0775.3323434