FastQCFastQC Report
Mon 27 Aug 2018
ribo_cut_trimmed.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenameribo_cut_trimmed.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences1181965961
Sequences flagged as poor quality0
Sequence length20-51
%GC66

[FAIL]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CGTGGGGGGCCCAAGTCCTTCTGATCGAGGCC65260100.55213180542684No Hit
GCTGGTCCGATGGTAGTGGGTTATCAGAA60166440.5090369941711037No Hit
TCAGTGCGCCCCGGGCGGGTCGCGCCGTCGGGCCCGGGGG59682160.5049397526601022No Hit
TCTCCCGGGGCTACGCCTGTCTGAGCGTCGCT58412610.49419874960341603No Hit
TCGCTTCTGGCGCCAAGCGCCCGGCCG47990060.406018968256904No Hit
TCCCGGGGCTACGCCTGTCTGAGCGTCGCT46240730.39121879585160063No Hit
GCTGGTCCGATGGTAGTGGGTTATCAGAAC42427020.3589529766500611No Hit
CCGCCGAGGGCGCACCACCGGCCCGTCTCGC42270250.3576266271173946No Hit
TCGCCGGCCGAGGTGGGATCCCGAGGCCTC37865560.3203608331323173No Hit
TCGACTGCATAATTTGTGGTAGTGGGGGA36804750.3113858707814345No Hit
TCGTGGGGGGCCCAAGTCCTTCTGATCGAGGCC36282220.3069650158901657No Hit
TGTGGGGGGGCCGGGCCACCCCTCCCACGGCGCGACC34011090.2877501647443805No Hit
TCGACTGCATAATTTGTGGTAGTGGGGG32111370.27167762067219126No Hit
AGTACATGCTAAGACTTCACCAGTCAAAGCGA31570730.2671035464785267No Hit
TCGCCCCGGGCGGGTCGCGCCGTCGGGCCCGGGGG25744700.21781253309713544No Hit
AGTGCGCCCCGGGCGGGTCGCGCCGTCGGGCCCGGGGG24963030.21119922928135829No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCG23231180.196546946075717No Hit
CTGGTCCGATGGTAGTGGGTTATCAGAA22212980.1879324848002116No Hit
TGTGGGGGGGCCGGGCCACCCCTCCCACGGCG22200190.18782427525423467No Hit
AACGATGCCGACCGGCGATGCGGCGGCGTT20934830.17711872161096862No Hit
AAAACGATGCCGACCGGCGATGCGGCGGCGTT19971270.1689665409916149No Hit
ATGTACACGGAGTCGACCCAACGCGA19358700.1637839044334374No Hit
TGTGGGGGGGCCGGGCCACCCCTCCCACGGCGCGACCGCTC19006600.16080496923887305No Hit
CTCGCTTCTGGCGCCAAGCGCCCGGCCGC18144600.15351203502213207No Hit
AAAACGATGCCGACCGGCGATGCGGCGGCGTTA17921550.15162492483994638No Hit
GCTGGTCCGATGGTAGTGGGTTATCAGAACT16807810.142202149254618No Hit
TCTGGTCCGATGGTAGTGGGTTATCAGAA16520050.13976756137734495No Hit
TAAACGATGCCGACCGGCGATGCGGCGGCGTT16234150.13734870999385743No Hit
GTTGAACCCCATTCGTGATGGGGATCGGGGATT15948680.13493349661699774No Hit
ACCTCTAGCATCACCAGTATTAGAGGC15243920.1289708883587723No Hit
TGCTGGTCCGATGGTAGTGGGTTATCAGAA14654580.12398478876330349No Hit
CTGGTCCGATGGTAGTGGGTTATCAGAAC14627720.12375754025627139No Hit
CTCCCGGGGCTACGCCTGTCTGAGCGTCGCT14039660.1187822700758808No Hit
ATAAGGCCTACTTCACAAAGCGCCTTCC13849790.11717587863767592No Hit
TCGGGGGGGATGCGTGCATTTATCAGA13250250.11210348214080253No Hit
CTCGCCGGCCGAGGTGGGATCCCGAGGCCTC13096580.11080336009777865No Hit
TCGCCGGCCGAGGTGGGATCCCGAGGC12914120.10925966082030004No Hit
TAAACGATGCCGACCGGCGATGCGGCGGCGTTA12775980.10809093003990493No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TTAGGCA749800.01709.214544
GCTTTAG777150.01626.961541
GTATGCA643500.01579.766644
TTTAGGC802350.01575.995143
TGTATGC644550.01573.825743
CTTTAGG832900.01496.094642
GCTGTAT588900.01458.87341
GGGCTTT868600.01429.300439
GGCTGTA1089550.01372.032240
GGGCTGT1243000.01329.748239
GTAGTCA316250.01322.808344
GGGGCTT919550.01283.694338
CTGTATG803300.01245.686842
GGCTTTA1022250.01244.928140
AGTCACC1179050.01222.789844
CAGTCAC1380200.01195.225143
GTAGACA207300.01088.937545
TCCAGTC2574850.01024.814643
GGGGCTG1642550.0996.1543638
CTCCAGT2659150.0977.566642