FastQCFastQC Report
Thu 17 Aug 2017
fastq1_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq1_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences192921039
Sequences flagged as poor quality0
Sequence length50
%GC49

[OK]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
CTGTAGGCACCATCAATAGATCGGAAGAGCACACGTCTGAACTCCAGTCA50403202.612633658892953Illumina Multiplexing PCR Primer 2.01 (100% over 33bp)
GCGCAGCGGAAGCGTGCTGGGCCTGTAGGCACCATCAATAGATCGGAAGA38842132.0133693142716282No Hit
GCGCAGCGGAAGCGTGCTGGGCTGTAGGCACCATCAATAGATCGGAAGAG14565880.7550177044194749No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTGTAGGCACCATCAATAG8135280.42168962193905657No Hit
GCCCGGATAGCTCAGTCGGTAGAGCATCAGACTGTAGGCACCATCAATAG8029720.41621795329435274No Hit
TTGGTGGTTCAGTGGTAGAATTCTCGCCTGTAGGCACCATCAATAGATCG6063510.314300090411601No Hit
GTCTAGTGGTTAGGATTCGGCGCTGTAGGCACCATCAATAGATCGGAAGA5637150.29219985695805833No Hit
TTGGTCTAGGGGTATGATTCTCGCTTCTGTAGGCACCATCAATAGATCGG4204750.21795186371560024No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGGGACTGTAGGCACCATCAATAG3240040.16794643118213767No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTGTAGGCACCATCAATAG3198230.16577922328108546No Hit
GTATAGTGGTGAGTATCCCCGCTGTAGGCACCATCAATAGATCGGAAGAG3180620.16486641459566265No Hit
GTCTAGGGGTATGATTCTCGCTTCTGTAGGCACCATCAATAGATCGGAAG2750100.14255054888025975No Hit
TTGGTGGTTCAGTGGTAGAATTCTCGCTGTAGGCACCATCAATAGATCGG2702730.1400951401676828No Hit
CTGTAGGCACCATTAATAGATCGGAAGAGCACACGTCTGAACTCCAGTCA2586790.1340854275618949Illumina Multiplexing PCR Primer 2.01 (100% over 33bp)
GCCCGGATAGCTCAGTCGGTAGAGCACTGTAGGCACCATCAATAGATCGG2537050.13150717066167159No Hit
GCGCAGCGGAAGCGTGCTGGGCCCTGTAGGCACCATCAATAGATCGGAAG2463180.12767814297330216No Hit
GTCTAGTGGTTAGGATTCGGCCTGTAGGCACCATCAATAGATCGGAAGAG2298400.11913682467778956No Hit
TCTCGCTTCTGGCGCCAAGCGCCCGTCCGCCTGTAGGCACCATCAATAGA2168940.11242630722095584No Hit
CTCGCTTCTGGCGCCAAGCGCCCGTCCGCCTGTAGGCACCATCAATAGAT2155600.11173483261200973No Hit
TTTGGTGGTTCAGTGGTAGAATTCTCGCCTGTAGGCACCATCAATAGATC2150950.11149380135776689No Hit
ATGTACACGGAGTCGACCCAACGCGACTGTAGGCACCATCAATAGATCGG2090250.10834743638302716No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGCTGTAGGCACCATCAATAGA1996840.1035055590800545No Hit
TCGCTTCTGGCGCCAAGCGCCCGTCCGCCTGTAGGCACCATCAATAGATC1993290.10332154597197665No Hit
TTGGTCTAGGGGTATGATTCTCGCCTGTAGGCACCATCAATAGATCGGAA1941890.10065724350572258No Hit

[WARN]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCGCAGC8230550.041.726661
CGCAGCG8548200.041.6257062
GAAGCGT8155700.041.423079
AGCGGAA8230050.041.2156835
AAGCGTG8136500.041.2015110
GGAAGCG8226500.041.1859368
CAGCGGA8268600.041.0309834
GCAGCGG8687850.041.0146453
AGCGTGC8546200.040.97701611
GCGGAAG8287550.040.9220736
GCGTGCT8609400.040.6896512
CCAGTCA7277100.040.56010444
CGGAAGC8368350.040.4932827
TCCAGTC7448900.039.60475543
CGGATAG2044750.039.3798034
AACTCCA7557150.039.1769940
CCGGCTA2452050.039.129043
GCCCGGC2420750.039.1222531
CGGCTAG2426950.039.0955664
CCCGGAT2284050.038.7596862