FastQCFastQC Report
Mon 27 Aug 2018
ribo_cutadapt.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenameribo_cutadapt.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences105198778
Sequences flagged as poor quality0
Sequence length25-76
%GC75

[FAIL]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
GCGCGCGGGTCGGGGGGCGGGGCGGACTGT96370589.160807932578836No Hit
CGCGCGCGGGTCGGGGGGCGGGGCGGACTGT56115065.334193140532488No Hit
CGCGCGGGTCGGGGGGCGGGGCGGACTGT36258443.446659808158608No Hit
GCGCGCGGGTCGGGGGGCGGGGCGGACTGTC24721002.3499322397071953No Hit
CGCGCGCGGGTCGGGGGGCGGGGCGGACTGTC18848761.7917280369929771No Hit
CCCCGCCCCTTGCCTCTCGGCGCCCC15957561.5168959472133794No Hit
GCGCGCGGGTCGGGGGGCGGGGCGGACTGTCC13917341.322956432060456No Hit
CGCGCGGGTCGGGGGGCGGGGCGGACTGTC11465891.0899261586479645No Hit
AGCCTCGGTTGGCCTCGGATAGCCGGTCCCC11147441.059654894470352No Hit
CGCGCGCGGGTCGGGGGGCGGGGCGGACTGTCC10894981.035656516846612No Hit
CGCGCGGGTCGGGGGGCGGGGCGGACTGTCC9894660.9405679598293433No Hit
ACCCCTCCTCCCCGCGCCCCCGCCCCGG8727180.8295894843949613No Hit
CCCCGCCCCTTGCCTCTCGGCGCCCCC8019390.7623082846076406No Hit
GCGCGCGGGTCGGGGGGCGGGGCGGACTG7734630.7352395291131614No Hit
GTGGGGGGGCCGGGCCACCCCTCCCACGGCGCGACC6624450.629707885009843No Hit
CACCGCCCGTCCCCGCCCCTTGCCTCTCGGC6568640.6244026903050147No Hit
GGTGGCGGCGGCGGCGGCGGCGGCGGGA6169640.5864744930782371No Hit
GCGCGCGGGTCGGGGGGCGGGGCGGACT5617460.5339852902093597No Hit
CACCGCCCGTCCCCGCCCCTTGCCTCTCGGCGCCC5537140.5263502205320294No Hit
AGCCTCGGTTGGCCTCGGATAGCCGGTCCCCCG5382410.5116418747753896No Hit
CACCGCCCGTCCCCGCCCCTTGCCTCTCGGCG5360290.5095391887536944No Hit
GCCTCGGTTGGCCTCGGATAGCCGGTCCCC5208450.49510556101706804No Hit
CCCCTCCTCCCCGCGCCCCCGCCCCGG4883930.46425729393928894No Hit
GGTGGCGGCGGCGGCGGCGGCGGCGGG3866510.36754324275515826No Hit
CGCGGGTCGGGGGGCGGGGCGGACTGT3801970.3614081905019847No Hit
CCGCCGAGGGCGCACCACCGGCCCGTCTCGCC3578280.340144635520386No Hit
CGCGCGCGGGTCGGGGGGCGGGGCGGACTG3470160.32986694959517493No Hit
GTGGGGGGGCCGGGCCACCCCTCCCACGGCGCGACCG3385160.32178700783007197No Hit
GCCTCGGTTGGCCTCGGATAGCCGGTCCCCCG3361850.31957120262366545No Hit
CGGTGGCGGCGGCGGCGGCGGCGGCGGGA3235250.30753684230058265No Hit
CACCCCTCCTCCCCGCGCCCCCGCCCCGG3213540.3054731301156369No Hit
GCGCGGGTCGGGGGGCGGGGCGGACTGT3134900.2979977581108404No Hit
CACCGCCCGTCCCCGCCCCTTGCCTCTCGGCGCC3096030.294302848270728No Hit
CCGCCGAGGGCGCACCACCGGCCCGTCTCGCCC3030610.28808414485575107No Hit
ACCCCTCCTCCCCGCGCCCCCGCCCCG2909400.2765621478987142No Hit
GAGCCTCGGTTGGCCTCGGATAGCCGGTCCCC2860280.2718928921398688No Hit
GCGGGTCGGGGGGCGGGGCGGACTGT2756730.26204962190720504No Hit
CGCGCGCGGGTCGGGGGGCGGGGCGGACT2754920.26187756667667755No Hit
ACCGCCCGTCCCCGCCCCTTGCCTCTCGGCGCCC2685090.2552396568712994No Hit
GGAGCCTCGGTTGGCCTCGGATAGCCGGTCCCC2624060.24943825868395542No Hit
GCGCGCGGGTCGGGGGGCGGGGCGGAC2621320.24917779938470386No Hit
GTGGGGGGGCCGGGCCACCCCTCCCACGGCGCGACCGCT2600210.24717112208280595No Hit
GGGGGGGATGCGTGCATTTATCAGAT2599170.24707226161885645No Hit
CGGTGGCGGCGGCGGCGGCGGCGGCGGG2462760.2341053809579423No Hit
CGCGCGGGTCGGGGGGCGGGGCGGACTG2435960.23155782284847454No Hit
GCGCGCGGGTCGGGGGGCGGGGCGGA2407750.22887623276384447No Hit
CCCCCCCGAGTGTTACAGCCCCCCCGGC2397220.22787527056635581No Hit
CGTGGGGGGGCCGGGCCACCCCTCCCACGGCGCGACC2290380.2177192590583134No Hit
CCCCGCCCCTTGCCTCTCGGCGCCC2258660.2147040149078538No Hit
GGGGCTCTCGCTTCTGGCGCCAAGCGCCCGGCCG2248930.2137790992210955No Hit
ACCGCCCGTCCCCGCCCCTTGCCTCTCGGC2240760.2130024742302615No Hit
CCGCCGAGGGCGCACCACCGGCCCGTCTCGC2200000.2091279045085486No Hit
TCCGCCGAGGGCGCACCACCGGCCCGTCTCGCC2177200.2069605789527327No Hit
CACCGCCCGTCCCCGCCCCTTGCCTCTCGG2170830.20635505861104206No Hit
CGCGCGGGTCGGGGGGCGGGGCGGACT2163410.20564972722401775No Hit
CCCCGCCCCTTGCCTCTCGGCGCCCCCT2066660.19645285233256227No Hit
AAATGGATTTTTGGAGCAGGGAGATGGA2022850.19228835528868976No Hit
GCATGGGTGGTTCAGTGGTAGAATTCT2013250.1913757971599252No Hit
AGGGGGACGGCGGAGCGAGCGCACGGG1903080.18090324205096756No Hit
GTGGGGGGGCCGGGCCACCCCTCCCACGGCGCGACCGC1876980.17842222463838886No Hit
CGGCGGATCTTTCCCGCCCCCCGTTCCTCCCGACCCCT1836170.17454290200975528No Hit
CGGGTCGGGGGGCGGGGCGGACTGT1834420.17437655026753257No Hit
CGGCGGATCTTTCCCGCCCCCCGTTCCTCCCGACCCC1797950.17090977995961132No Hit
CACCGCCCGTCCCCGCCCCTTGCCTCTCGGCGC1746200.16599052129673977No Hit
CCGCCGAGGGCGCACCACCGGCCCGTCTCGCCCG1723970.1638773788798193No Hit
ACCGCCCGTCCCCGCCCCTTGCCTCTCGGCG1722780.16376425969510786No Hit
TGGGCGCGCGCCGCGGCTGGACGAGGCGCCGCCGCC1697960.16140491669969778No Hit
AGCCTCGGTTGGCCTCGGATAGCCGGTCCCCCGC1696110.16122905914363378No Hit
AGCCTCGGTTGGCCTCGGATAGCCGGTCCCCC1634820.15540294584030245No Hit
TCCGCCGAGGGCGCACCACCGGCCCGTCTCGCCC1623980.15437251561990578No Hit
GGGGGGGATGCGTGCATTTATCAGATCAAAA1607330.1527897976153297No Hit
CGCGCGGCGGCGGCGGCGGGCGGCGGAGGGGC1536110.1460197569975575No Hit
CGGGGGGGATGCGTGCATTTATCAGAT1463860.13915180649721995No Hit
ACCCCTCCTCCCCGCGCCCCCGCCCCGGC1412740.1342924344615486No Hit
GGGGGGGATGCGTGCATTTATCAGATC1408270.1338675245828426No Hit
TCCGCCGAGGGCGCACCACCGGCCCGTCTCGC1391120.13223727750906006No Hit
GCGGGTCGGGGGGCGGGGCGGACTGTCC1370550.13028193160190513No Hit
GGTGGCGGCGGCGGCGGGGGCGGCGGGA1303720.12392919621176587No Hit
GCGGGTCGGGGGGCGGGGCGGACTGTC1302650.123827484003664No Hit
GAGCCTCGGTTGGCCTCGGATAGCCGGTCCCCCG1294260.12302994622237912No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGA1286750.12231605960289767No Hit
CGCGGGTCGGGGGGCGGGGCGGACTGTC1280930.12176282123733415No Hit
CACCGCCCGTCCCCGCCCCTTGCCTCT1268620.12059265555347039No Hit
GTGGCGGCGGCGGCGGCGGCGGCGGGA1266100.12035310904466971No Hit
CGCGGGTCGGGGGGCGGGGCGGACTGTCC1255020.11929986487105393No Hit
CGCGCGCGGGTCGGGGGGCGGGGCGGAC1251730.11898712359567523No Hit
GCCTCGGTTGGCCTCGGATAGCCGGTCCCCCGC1242800.11813825441964734No Hit
CGGGGGGGATGCGTGCATTTATCAGATC1237460.11763064396052206No Hit
CGCGCGCGGGTCGGGGGGCGGGGCGGA1211170.11513156550164491No Hit
CACCCCTCCTCCCCGCGCCCCCGCCCCG1193430.1134452341261987No Hit
CCCCTCCTCCCCGCGCCCCCGCCCCG1160040.1102712428845894No Hit
GCGCCCCGGGCGGGTCGCGCCGTCGGGCCCGGGGG1154400.1097351149839402No Hit
TGCGCCCCGGGCGGGTCGCGCCGTCGGGCCCGGGGG1147700.10909822545657327No Hit
GGGCCGCCGGTGAAATACCACTACTCTGAT1120610.10652310048696573No Hit
CCGCCGAGGGCGCACCACCGGCCCGTCTCGCCCGC1086540.10328446971123562No Hit
ACCGCCCGTCCCCGCCCCTTGCCTCTCGGCGCCCC1085770.10321127494465764No Hit
CGTGGGGGGGCCGGGCCACCCCTCCCACGGCGCGACCG1072460.10194605112238092No Hit
GCGCGGGTCGGGGGGCGGGGCGGACTGTC1062470.10099642031963527No Hit
CACCGCCCGTCCCCGCCCCTTGCCTCTC1059830.10074546683422501No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
AACTCCC35050.01142.2670
TTAACTC13700.0782.5733667
GCACACG64450.0754.467459
TAACCCC25050.0748.9898767
GAACTCC101250.0742.321169
CGTCTAA7050.0724.2677665
ACACGTC64050.0723.804762
AACTCCA78500.0719.653769
CACACGT56000.0713.5143460
TAACTCC18100.0705.651368
ACTCCAG73550.0697.957570
ACGTCTA8350.0669.7463465
AGCACAC78150.0661.536358
CGTCTTA8100.0660.094464
TAGATCG55950.0655.026348
GCGCACA14150.0649.672659
TGAACTC111150.0647.4757768
TAAACCC38950.0644.351367
TCTGAAC96650.0642.1684666
CGTCTGA85700.0635.236764