FastQCFastQC Report
Fri 13 Jan 2017
fastq1_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq1_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences91011041
Sequences flagged as poor quality0
Sequence length51
%GC54

[OK]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACGCGAACTCGGCCTACAATAGTGAGGATCGTATGCCGTCTTCTGCTTGA11750201.2910741236329777Illumina Single End Adapter 1 (95% over 23bp)
CGCCGCGGCCCGGGTTCGATTCCCGGTCAGGTCGTATGCCGTCTTCTGCTT9898061.087566946959765Illumina PCR Primer Index 1 (95% over 21bp)
AACGCGAACTCGGCCTACAATAGTGAGTCGTATGCCGTCTTCTGCTTGAAA6200400.681279977887518Illumina Single End Adapter 2 (95% over 22bp)
AGGTCGCTGGTTCGTTTCCGGCTCGAAGGTCGTATGCCGTCTTCTGCTTGA6000490.6593145110822324Illumina Single End Adapter 2 (95% over 24bp)
CGCGGGAGACCGGGGTTCGATTCCCCGACGGGTCGTATGCCGTCTTCTGCT5770400.6340329630994991Illumina Single End Adapter 1 (95% over 21bp)
ATGGTCTAGCGGTTAGGATTCCTGGTCGTATGCCGTCTTCTGCTTGAAAAA5188320.5700758878255222Illumina Single End Adapter 2 (95% over 23bp)
AGGTCGCTGGTTCGTTTCCGGCTCGAAGTCGTATGCCGTCTTCTGCTTGAA5048720.5547370895362025Illumina Single End Adapter 1 (95% over 22bp)
CGGGAGACCGGGGTTCGATTCCCCGACGGTCGTATGCCGTCTTCTGCTTGA5000020.5493860904195129Illumina Single End Adapter 1 (95% over 23bp)
AGGTCGCTGGTTCGATTCCGGCTCGAAGGTCGTATGCCGTCTTCTGCTTGA4561700.501224900833735Illumina Single End Adapter 2 (95% over 24bp)
CGCGGGAGACCGGGGTTCGATTCCCCGACGGTCGTATGCCGTCTTCTGCTT4400330.4834940850747988Illumina Single End Adapter 1 (95% over 22bp)
CCCTGGTGGTCTAGTGGTTAGGATTCGGTCGTATGCCGTCTTCTGCTTGAA4050060.4450075458427072Illumina Single End Adapter 2 (95% over 23bp)
CGGGAGACCGGGGTTCGATTCCCCGACGGGTCGTATGCCGTCTTCTGCTTG3723360.4091108022816704Illumina Single End Adapter 1 (95% over 23bp)
GCGGGAGACCGGGGTTCGATTCCCCGACGGTCGTATGCCGTCTTCTGCTTG3614400.39713862848794357Illumina Single End Adapter 1 (95% over 23bp)
CGCGGCCCGGGTTCGATTCCCGGTCAGGGTCGTATGCCGTCTTCTGCTTGA3397110.3732635032709933Illumina Single End Adapter 2 (95% over 23bp)
AGGTCGCTGGTTCGATTCCGGCTCGAAGTCGTATGCCGTCTTCTGCTTGAA3103420.3409937921707763Illumina Single End Adapter 1 (95% over 22bp)
CGCCGCGGCCCGGGTTCGATTCCCGGTCAGGGTCGTATGCCGTCTTCTGCT3034200.333388121557691Illumina Single End Adapter 2 (95% over 21bp)
GGTCGCTGGTTCGTTTCCGGCTCGAAGGTCGTATGCCGTCTTCTGCTTGAA3002060.32985668189423306Illumina Single End Adapter 2 (95% over 24bp)
AGGTCGCTGGTTCGAATCCGGCTCGAAGGTCGTATGCCGTCTTCTGCTTGA2997180.3293204832147783Illumina Single End Adapter 2 (95% over 24bp)
AGCGTGTACTCCGAAGAGGATCCAAATCGTATGCCGTCTTCTGCTTGAAAA2988530.3283700490800891Illumina PCR Primer Index 3 (95% over 22bp)
AGCGTGTACTCCGAAGAGGATCCAAACTCGTATGCCGTCTTCTGCTTGAAA2956300.3248287205065592TruSeq Adapter, Index 4 (96% over 27bp)
GCGGGAGACCGGGGTTCGATTCCCCGACGGGTCGTATGCCGTCTTCTGCTT2835850.311594062526985Illumina Single End Adapter 1 (95% over 22bp)
AGGTCGCTGGTTCGAATCCGGCTCGAAGTCGTATGCCGTCTTCTGCTTGAA2801350.3078033136660858Illumina Single End Adapter 1 (95% over 22bp)
AGGAGATCCTGGGTTCGAATCCCAGCGGGGTCGTATGCCGTCTTCTGCTTG2753840.30258306791590267Illumina Single End Adapter 1 (95% over 23bp)
GGGAGACCGGGGTTCGATTCCCCGACGGGTCGTATGCCGTCTTCTGCTTGA2434270.26746974578611843Illumina Single End Adapter 1 (95% over 23bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGTCGTATGCCGTCTTCTGCTTGA2385900.26215500600635916Illumina Single End Adapter 2 (95% over 23bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGATCGTATGCCGTCTTCTGCTT2347220.257904972211009Illumina Single End Adapter 2 (95% over 24bp)
ATGGTCTAGCGGTTAGGATTCCTGGTTCGTATGCCGTCTTCTGCTTGAAAA2133060.234373761311004Illumina Single End Adapter 1 (95% over 23bp)
CCTGGTGGTCTAGTGGTTAGGATTCGGTCGTATGCCGTCTTCTGCTTGAAA2097360.23045116031581267Illumina Single End Adapter 2 (95% over 23bp)
GGTCGCTGGTTCGATTCCGGCTCGAAGGTCGTATGCCGTCTTCTGCTTGAA2070860.22753942568352778Illumina Single End Adapter 2 (95% over 24bp)
GCGGCCCGGGTTCGATTCCCGGTCAGGTCGTATGCCGTCTTCTGCTTGAAA2025810.22258947680864347Illumina Paired End PCR Primer 2 (95% over 22bp)
CCAGGCGGCCCGGGTTCGACTCCCGGTGTGGTCGTATGCCGTCTTCTGCTT1977550.21728682347452766Illumina PCR Primer Index 4 (95% over 21bp)
AGGAGATCCTGGGTTCGAATCCCAGCGGTGTCGTATGCCGTCTTCTGCTTG1963460.21573865966438072TruSeq Adapter, Index 14 (95% over 24bp)
AGGTCGCTGGTTCGTTTCCGGCTCGAAGGATCGTATGCCGTCTTCTGCTTG1901650.20894717598054943Illumina Single End Adapter 1 (95% over 23bp)
AGCAGAGTGGCGCAGCGGAAGCGTGCTGGTCGTATGCCGTCTTCTGCTTGA1846600.20289845931989722Illumina Single End Adapter 2 (95% over 23bp)
CCGCGGCCCGGGTTCGATTCCCGGTCAGGTCGTATGCCGTCTTCTGCTTGA1838460.2020040623422822Illumina PCR Primer Index 1 (95% over 22bp)
AGCAGAGTGGCGCAGCGGAAGCGTGCTGGGTCGTATGCCGTCTTCTGCTTG1831870.20127997437146117Illumina Single End Adapter 2 (95% over 23bp)
AGCAGAGTGGCGCAGCGGAAGCGTGCTTCGTATGCCGTCTTCTGCTTGAAA1826290.20066686194700264Illumina Single End Adapter 1 (95% over 22bp)
ACATGGTCTAGCGGTTAGGATTCCTGGTCGTATGCCGTCTTCTGCTTGAAA1803640.19817815291223842Illumina Single End Adapter 2 (95% over 23bp)
AGGAGATCCTGGGTTCGAATCCCAGCGGTCGTATGCCGTCTTCTGCTTGAA1781310.19572460444661874Illumina Single End Adapter 1 (95% over 23bp)
CGCAGCAACCTCGGTTCGAATCCGAGTCACGGTCGTATGCCGTCTTCTGCT1766910.19414237883511298No Hit
AGGTCGCTGGTTCGTTTCCGGCTCGAATCGTATGCCGTCTTCTGCTTGAAA1709440.18782776037030496Illumina Single End Adapter 1 (95% over 22bp)
AGAGTGGCGCAGCGGAAGCGTGCTGGGTCGTATGCCGTCTTCTGCTTGAAA1658030.18217899518367228Illumina Single End Adapter 2 (95% over 23bp)
CGGCCCGGGTTCGACTCCCGGTGTGGGTCGTATGCCGTCTTCTGCTTGAAA1641620.18037591724722718Illumina Single End Adapter 2 (95% over 23bp)
CCCTGGTGGTCTAGTGGTTAGGATTCGGCGTCGTATGCCGTCTTCTGCTTG1618330.17781688707417379Illumina Single End Adapter 2 (95% over 22bp)
GGTCGCTGGTTCGTTTCCGGCTCGAAGTCGTATGCCGTCTTCTGCTTGAAA1613890.17732903417729284Illumina Single End Adapter 1 (95% over 22bp)
AGGTCGCTGGTTCGAATCCGGCTCGGAGTCGTATGCCGTCTTCTGCTTGAA1585160.1741722743287817Illumina Paired End PCR Primer 2 (95% over 22bp)
AACGCGAACTCGGCCTACAATAGTGATCGTATGCCGTCTTCTGCTTGAAAA1534760.16863448468851158Illumina Single End Adapter 2 (95% over 23bp)
GGTCGCTGGTTCGTTTCCGGCTCGAAGGATCGTATGCCGTCTTCTGCTTGA1533510.1684971387152906Illumina Single End Adapter 1 (95% over 23bp)
CCCACATGGTCTAGCGGTTAGGATTCCTGGTCGTATGCCGTCTTCTGCTTG1501040.1649294397149023Illumina Single End Adapter 2 (95% over 23bp)
GGTCGCTGGTTCGAATCCGGCTCGAAGGTCGTATGCCGTCTTCTGCTTGAA1460150.1604365782388974Illumina Single End Adapter 2 (95% over 24bp)
AGGTCGCTGGTTCGATTCCGGCTCGAAGGATCGTATGCCGTCTTCTGCTTG1455830.1599619105554457Illumina Single End Adapter 1 (95% over 23bp)
GCGGCCCGGGTTCGATTCCCGGTCAGGGTCGTATGCCGTCTTCTGCTTGAA1454260.15978940401308014Illumina Single End Adapter 2 (95% over 23bp)
GGGAGACCGGGGTTCGATTCCCCGACGGTCGTATGCCGTCTTCTGCTTGAA1416090.15559540737480412Illumina Single End Adapter 1 (95% over 23bp)
CAGGAGATCCTGGGTTCGAATCCCAGCGGGGTCGTATGCCGTCTTCTGCTT1404560.15432852811781375Illumina Single End Adapter 1 (95% over 22bp)
CGGGAGACCGGGGTTCAATTCCCCGACGGGTCGTATGCCGTCTTCTGCTTG1357950.14920717146834964Illumina Single End Adapter 1 (95% over 23bp)
CGCGGGAGACCGGGGTTCGATTCCCCGACGGGGTCGTATGCCGTCTTCTGC1355900.14898192407226724No Hit
AGAGTGGCGCAGCGGAAGCGTGCTGGTCGTATGCCGTCTTCTGCTTGAAAA1354990.14888193620376236Illumina Single End Adapter 2 (95% over 23bp)
ATATGGTCTAGCGGTTAGGATTCCTGGTCGTATGCCGTCTTCTGCTTGAAA1354720.14885226947354663Illumina Single End Adapter 2 (95% over 23bp)
AACCTCGGTTCGAATCCGAGTCACGGTCGTATGCCGTCTTCTGCTTGAAAA1350280.1483644165766657Illumina Paired End PCR Primer 2 (95% over 22bp)
AGGGTCGTGGGTTCGAGCCCCACGTTGGTCGTATGCCGTCTTCTGCTTGAA1345590.14784909448514055Illumina Single End Adapter 1 (95% over 23bp)
AACGCGAACTCGGCCTACAATAGTGAGGTCGTATGCCGTCTTCTGCTTGAA1329150.14604272024533813Illumina Single End Adapter 1 (96% over 25bp)
AGCAGAGTGGCGCAGCGGAAGCGTGCTGGGCTCGTATGCCGTCTTCTGCTT1314850.14447148231169007TruSeq Adapter, Index 21 (95% over 24bp)
AGGAGATCCTGGGTTCGAATCCCAGCGGGTCGTATGCCGTCTTCTGCTTGA1303640.14323976362384427Illumina Single End Adapter 1 (95% over 23bp)
ATTAACGCGAACTCGGCCTACAATAGTGAGGATCGTATGCCGTCTTCTGCT1294690.14225636645558204Illumina Single End Adapter 1 (95% over 21bp)
TCCCACATGGTCTAGCGGTTAGGATTCCTGGTCGTATGCCGTCTTCTGCTT1280160.14065985686286128Illumina Single End Adapter 2 (95% over 22bp)
ATGGTCTAGCGGTTAGGATTCCTGTCGTATGCCGTCTTCTGCTTGAAAAAA1237540.13597690855991856TruSeq Adapter, Index 16 (96% over 25bp)
CGGGAGACCGGGGTTCGATTCCCCGACGGGGTCGTATGCCGTCTTCTGCTT1207830.1327124694684022Illumina Single End Adapter 1 (95% over 22bp)
CGGGAGACCGGGGTTCAATTCCCCGACGGTCGTATGCCGTCTTCTGCTTGA1204560.1323531724024561Illumina Single End Adapter 1 (95% over 23bp)
CCAGGCGGCCCGGGTTCGACTCCCGGTGTGGGTCGTATGCCGTCTTCTGCT1160010.12745816191686016Illumina Single End Adapter 2 (95% over 21bp)
CCCATATGGTCTAGCGGTTAGGATTCCTGGTCGTATGCCGTCTTCTGCTTG1154560.1268593334736167Illumina Single End Adapter 2 (95% over 23bp)
AGGTCGCTGGTTCGAATCCGGCTCGGAGGTCGTATGCCGTCTTCTGCTTGA1141320.12540456492526Illumina Single End Adapter 1 (96% over 25bp)
TGCGAGAGGTCCCGGGTTCAAATCCCGGACGAGTCGTATGCCGTCTTCTGC1118250.12286970764349349No Hit
TCCCACATGGTCTAGCGGTTAGGATTCCTGGTTCGTATGCCGTCTTCTGCT1113690.12236866953318334Illumina Single End Adapter 1 (95% over 21bp)
AGGTCGCTGGTTCGAATCCGGCTCGGAGGACTCGTATGCCGTCTTCTGCTT1094580.12026892429458091TruSeq Adapter, Index 21 (95% over 24bp)
AGGTCGCTGGTTCGATTCCGGCTCGAAGGACTCGTATGCCGTCTTCTGCTT1044680.11478607304359917TruSeq Adapter, Index 21 (95% over 24bp)
TCCCATATGGTCTAGCGGTTAGGATTCCTGGTCGTATGCCGTCTTCTGCTT1032250.1134203046858897Illumina Single End Adapter 2 (95% over 22bp)
ACATGGTCTAGCGGTTAGGATTCCTGTCGTATGCCGTCTTCTGCTTGAAAA1008610.11082281764033444TruSeq Adapter, Index 16 (96% over 25bp)
AGGTCGCTGGTTCGATTCCGGCTCGAATCGTATGCCGTCTTCTGCTTGAAA989510.10872417116951777Illumina Single End Adapter 1 (95% over 22bp)
AGAGTGGCGCAGCGGAAGCGTGCTGGGCTCGTATGCCGTCTTCTGCTTGAA986210.10836157780021437TruSeq Adapter, Index 21 (96% over 25bp)
AGGTGGCCCGGGTTCGACTCCCGGTATGGTCGTATGCCGTCTTCTGCTTGA980300.10771220603882556Illumina Single End Adapter 1 (95% over 23bp)
TTGGTGGTTCAGTGGTAGAATTCTCGCTCGTATGCCGTCTTCTGCTTGAAA967740.1063321536999011Illumina Single End Adapter 1 (95% over 24bp)
AGGTCGCTGGTTCGTTTCCGGCTCGAAGGACTCGTATGCCGTCTTCTGCTT953660.10478508865753991TruSeq Adapter, Index 21 (95% over 24bp)
GGTCGCTGGTTCGATTCCGGCTCGAAGTCGTATGCCGTCTTCTGCTTGAAA929620.10214365090055393Illumina Single End Adapter 1 (95% over 22bp)
GGTCGCTGGTTCGATTCCGGCTCGAAGGATCGTATGCCGTCTTCTGCTTGA923540.10147560008680705Illumina Single End Adapter 1 (95% over 23bp)
AGGTCGCTGGTTCGAATCCGGCTCGAATCGTATGCCGTCTTCTGCTTGAAA923500.10147120501566398Illumina Single End Adapter 1 (95% over 22bp)

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TCCCATA205500.042.83621
TCCCACA316700.042.6923141
CGTGTAC692600.042.603743
AGCGTGT693100.042.5402831
GTGTACT699700.042.2661974
TGTACTC699600.042.2628945
GCGTGTA702100.042.0651322
GTACTCC709550.041.7716566
TCCTTAG221750.041.3422931
CGTGGGG2289350.041.2635421
TACTCCG717750.041.238177
CGCGGGA1686100.041.1869851
AGCAGAG1435250.040.2219281
TGCGAGA603950.039.7962951
AGGTCGC6953550.039.74381
GCTAGCT622000.039.6653676
GCAGAGT1454600.039.6062932
ACTCCGA749800.039.5774238
CTAGCTC632200.039.523747
CGCAGCA402650.039.3845061