FastQCFastQC Report
Wed 4 Jan 2017
fastq1_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq1_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences91632500
Sequences flagged as poor quality0
Sequence length40
%GC54

[OK]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
ACATATACTAAAATTGGAACGATACAGAGAAAGATCGGAA1482730.16181267563364526No Hit

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ACATATA238750.025.1371021
CCGTAGT86850.023.8755425
CATATAC255200.023.569822
GTAGTGT91350.023.0350237
GTGTAGT157100.022.6882210
ATATACT265850.022.6638583
CGTAGTG94300.021.8275976
TAGTGTA107300.021.3375328
TCGGCCG268700.021.2472741
GATTCGC161600.020.87252217
GTCTAGT295400.020.6912810
TATACTA293750.020.5348434
GGCTAGC153750.020.4291425
ATACTAA296500.020.3214535
ATTCGCC169900.020.21271118
TTGACGT61350.019.8085371
TCTAGTG309350.019.80244411
GCTAGCT161700.019.7720746
GTGTAAT116450.019.7624171
TGTAGTG182500.019.57735311