FastQCFastQC Report
Tue 28 Aug 2018
fastq1_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq1_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences3365218
Sequences flagged as poor quality0
Sequence length25-50
%GC54

[OK]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
GGGCCCAAGTCCTTCTGATCGAGGCCCCCCTTGTAAATTTAACTGTTAGT455601.3538498843165583No Hit
TGACTCTAGATAACCTCGGGCCGATCGCATTTGGTGACTCTAGATAACCT335890.9981225584791238No Hit
AGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTG335760.9977362536394373TruSeq Adapter, Index 7 (100% over 50bp)
TGACTCTAGATAACCTCGGGCCGATCGCACTTTGGTGACTCTAGATAACC308340.9162556482224925No Hit
TAACTGTGGTAATTCTAGAGCTAATACATGCTTTGGTGACTCTAGATAAC256290.7615851335634125No Hit
GGGGCCCAAGTCCTTCTGATCGAGGCCCCCCTTGTAAATTTAACTGTTAG236450.7026290718758784No Hit
GGGGCCCAAGTCCTTCTGATCGAGGCCCGCGACCTCAGATCAGACGTGGC232710.6915153787956679No Hit
GACTCTAGATAACCTCGGGCCGATCGCATTTGGTGACTCTAGATAACCTC150150.44618208983786495No Hit
GGGCCCAAGTCCTTCTGATCGAGGCCCGCGACCTCAGATCAGACGTGGCG140040.4161394596130176No Hit
GACTCTAGATAACCTCGGGCCGATCGCACTTTGGTGACTCTAGATAACCT127330.37837073259444115No Hit
GGCCCAAGTCCTTCTGATCGAGGCCCCCCTTGTAAATTTAACTGTTAGTC115830.3441976121606386No Hit
TGACTCTAGATAACCTCGGGCCGATCGCATTGGTGACTCTAGATAACCTC111200.33043921671642074No Hit
TGACTCTAGATAACCTCGGGCCGATCGCACTTGGTGACTCTAGATAACCT100720.29929710348631205No Hit
GCATAATTTGTGGTAGTGGGGATTATACCCACACCCACCCAAGAACAGGG99940.2969792744481932No Hit
ACTCTGGCATGCTAACTAGTTACGCGACCCCGGGGGGGATGCGTGCATTT98670.2932053733220255No Hit
GGCCCAAGTCCTTCTGATCGAGGCCCGCGACCTCAGATCAGACGTGGCGA94380.2804573136123722No Hit
GGGGCCCAAGTCCTTCTGATCGAGGCCTTGGTGACTCTAGATAACCTCGG89390.2656291509197918No Hit
GGGGCCCAAGTCCTTCTGATCGAGGCCGCGACCTCAGATCAGACGTGGCG88960.26435137337313663No Hit
CGGAGGGAAGCTCATCAGTGGGGCC80870.240311326041879No Hit
GGGCCCAAGTCCTTCTGATCGAGGCCTTGGTGACTCTAGATAACCTCGGG73680.2189456968315277No Hit
CCTCAGATCAGACGTGGCGACCCGCTGACGCGACCTCAGATCAGACGTGG73010.21695474111929747No Hit
CGGAGGGAAGCTCATCAGTGGGGCCACGAGCTG72680.21597412114163184No Hit
ACTCTGGCATGCTAACTAGTTACGCGACCCCACGAGACTCTGGCATGCTA67850.20162141055943475No Hit
GCATAATTTGTGGTAGTGGGGTTATACCCACACCCACCCAAGAACAGGGT66230.19680745794180346No Hit
ATAACTGTGGTAATTCTAGAGCTAATACATGCTTTGGTGACTCTAGATAA64810.19258782046215134No Hit
ACCCCATTCGTGATGGGGATCGGGGATTGACGAGACTCTGGCATGCTAAC63390.18836818298249922No Hit
GGCCCAAGTCCTTCTGATCGAGGCCGCGACCTCAGATCAGACGTGGCGAC60430.17957231894040743No Hit
GGGCCCAAGTCCTTCTGATCGAGGCCGCGACCTCAGATCAGACGTGGCGA56720.16854777313089375No Hit
GGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTC54420.16171314904413325TruSeq Adapter, Index 7 (100% over 50bp)
AACCCCATTCGTGATGGGGATCGGGGATTGACGAGACTCTGGCATGCTAA51320.15250126440545603No Hit
GACTCTAGATAACCTCGGGCCGATCGCATTGGTGACTCTAGATAACCTCG50750.15080746626221542No Hit
GCATAATTTGTGGTAGTGGGGGATTATACCCACACCCACCCAAGAACAGG50450.14991599355524662No Hit
GTGGACGGTGTGAGGCCGGTAGCGGCCCCCGCGTGGGGGGCCCAAGTCCT46630.13856457441984443No Hit
CCAAGGAGTCTAACACGTGCGCGAGTCGGGGTTTGGTGACTCTAGATAAC41800.12421186383764736No Hit
TTGGCCTCGGATAGCCGGTCCCCCGTGGGGGGCCCAAGTCCTTCTGATCG41060.12201289782712442No Hit
GGGGCCCAAGTCCTTCTGATCGAGGCCTTTGGTGACTCTAGATAACCTCG39760.1181498494302598No Hit
TTGGCCTCGGATAGCCGGTCCCCGTGGGGGGCCCAAGTCCTTCTGATCGA37540.11155295139869095No Hit
CCTCAGATCAGACGTGGCGACCCGCTGAGCGACCTCAGATCAGACGTGGC36410.10819507086910862No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTCTTC86850.060.2293342
GTCTTCT87600.059.6624743
CCGTCTT87050.058.28497741
TCTTCTG89650.058.26670544
GCCGTCT87700.056.7651840
TGCCGTC100250.048.8515739
ATGCCGT102750.046.8374138
GTATGCC106500.044.1629336
CGTATGC105800.043.89846835
TCGTATG105250.043.44438634
CTCGTAT105150.042.86908333
TCTCGTA104750.042.2378532
ATCTCGT105600.041.44445831
ATTCGCG1900.040.92665529
CATCTCG73500.040.51376730
GTAATCT32150.040.04905328
AATCTCG33250.039.9524430
TAATCTC33000.039.66578329
TCATCTC43950.039.5143229
TGTAATC33050.038.14452727