FastQCFastQC Report
Fri 7 Jul 2017
fastq1_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq1_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences167319253
Sequences flagged as poor quality0
Sequence length36-58
%GC49

[FAIL]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGATATCTCGTATGCCGTCTTC46983952.8080420607663124TruSeq Adapter, Index 12 (97% over 37bp)
AGGCTGAGGCGTGATGACGAGGCAGATCGGAAGAGCACACGTCTGAACTCCAGTCACC1862490.11131354979214496Illumina Multiplexing PCR Primer 2.01 (100% over 34bp)
AGGCTGAGGCGTGATGACGAGGCAAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC1844900.11026226611231645Illumina Multiplexing PCR Primer 2.01 (100% over 34bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CAGACAT5726950.058.41773651
GCAGACA5804000.057.6149750
AGACATG5876400.057.11163752
TTCGAGC5694200.056.6826445
CGAGCAG5683650.056.373547
TCGAGCA5690350.056.36512846
TATGCCG6800250.053.74857347
GTATGCC6798200.053.74828746
GCCGTCT6831950.053.48137750
ATGCCGT6853500.053.4520148
TGCCGTC6918650.053.1734749
CCGTCTT6976400.052.59114551
CGTATGC7097850.051.88335445
CGTCTTC6983600.051.7434352
CGGCCGC5723550.049.44207838
AGCAGAC6528450.049.3384849
GCGGCCG5773450.049.0812537
GCCGCTT5722200.049.0640540
GGCCGCT5723150.049.0570739
CGCTTCG5699300.048.78174242