FastQCFastQC Report
Wed 23 Nov 2016
fastq2_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq2_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences18083340
Sequences flagged as poor quality0
Sequence length50
%GC50

[OK]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
CTGTAGGCACCATCAATTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAA11238376.214764529119067Illumina Single End Adapter 1 (95% over 22bp)
TAGTCACTTAGCGATGTACACTGACTGTGCTGTAGGCACCATCAATTCGT2730461.5099312405783445No Hit
CCTGTAGGCACCATCAATTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAA1860191.0286761184604172Illumina Single End Adapter 1 (95% over 22bp)
CTGTAGGCACCATCAATTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAT1547260.8556273343309366Illumina Single End Adapter 1 (95% over 22bp)
ACCTGTAGGCACCATCAATTCGTATGCCGTCTTCTGCTTGAAAAAAAAAA1409200.7792808186983158Illumina Single End Adapter 1 (95% over 22bp)
CAAGACCTCAGCATGGCTCGGAGGCTATGGCTGTAGGCACCATCAATTCG682700.3775298147355522No Hit
CAAGACCTCAGCATGGCTCGGAGGCTATGGACTGTAGGCACCATCAATTC629300.3479998717051164No Hit
CTGTAGGCACCATCAATTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAG604670.3343796002287188Illumina Single End Adapter 1 (95% over 22bp)
CAAGACCTCAGCATGGCTCGGAGGCTATGGATCTGTAGGCACCATCAATT580300.3209031075011585No Hit
AGTCACTTAGCGATGTACACTGACTGTGCTGTAGGCACCATCAATTCGTA520970.28809390300685606No Hit
CATACCATCGGCATGTCGGCCGACAAATCGCCTGTAGGCACCATCAATTC480410.26566441818823294No Hit
CTGTAGGCACCATCAATTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAC457730.25312248732811526Illumina Single End Adapter 1 (95% over 22bp)
CTGTAGGCACCATCAATTCGTATGCCGTCTTCTGCTTGAAAAAAAAAATA402580.22262480271896673Illumina Single End Adapter 1 (95% over 22bp)
CATACCATCGGCATGTCGGCCGACAAATCGCTGTAGGCACCATCAATTCG397360.2197381678384635No Hit
CTGTAGGCACCATCAATTCGTATGCCGTCTTCTGCTTGAAAAAAAAAATT345880.1912699755686726Illumina Single End Adapter 1 (95% over 22bp)
CAGTCACTTAGCGATGTACACTGACTGTGCTGTAGGCACCATCAATTCGT333270.18429670625006223No Hit
GCGCAGCGGAAGCGTGCTGGGCCCCTGTAGGCACCATCAATTCGTATGCC321790.17794832149370637No Hit
GAGTCACTTAGCGATGTACACTGACTGTGCTGTAGGCACCATCAATTCGT287120.15877597833143656No Hit
CATACCATCGGCATGTCGGCCGACAAATCGCACTGTAGGCACCATCAATT270150.14939164999386176No Hit
GCGCAGCGGAAGCGTGCTGGGCCCTGTAGGCACCATCAATTCGTATGCCG236270.13065617302998228No Hit
CAAGACCTCAGCATGGCTCGGAGGCTATGCTGTAGGCACCATCAATTCGT218710.12094557753158432No Hit
GTCTAGGGGTATGATTCTCGCTTCTGTAGGCACCATCAATTCGTATGCCG209880.11606263002299354No Hit
CTGTAGGCACCATCAATTCGTATGCCGTCTTCTGCTTGAAAAAAAAAATC200800.1110414337174438Illumina Single End Adapter 1 (95% over 22bp)
AGCAGAGTGGCGCAGCGGAAGCGTGCTGGGCCCCTGTAGGCACCATCAAT196460.10864143460223609No Hit
CCTGTAGGCACCATCAATTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAT187780.1038414363718207Illumina Single End Adapter 1 (95% over 22bp)

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TAGTCAC334200.042.69371
AGTCACT498850.036.230992
GTCACTT512650.035.3882643
TCACTTA514200.035.3593864
CACTTAG535150.035.220015
TCGTTTT60300.035.181731
CAATACC41500.034.7146761
ACTTAGC544450.034.48376
GCAGAGT113150.034.3725132
TTAGCGA546750.034.274458
CTTAGCG550950.034.136597
TAGCGAT549000.034.050079
AGCGATG564350.033.53982510
GCGATGT557800.033.51157411
CGATGTA563100.033.24678412
GTACACT547550.033.05447816
ACACTGA546750.032.99257318
GATGTAC560200.032.8675113
CATACCA199150.032.7627031
ATACCAT203300.032.729062