FastQCFastQC Report
Mon 3 Apr 2017
fastq1_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq1_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences56823109
Sequences flagged as poor quality0
Sequence length35-36
%GC40

[OK]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGTACACGGAGTCGACCCGCAACGCGAAAAAAAA5142980.9050859923908774No Hit
ATGTACACGGAGTCGACCCGCAACGCAAAAAAAAA4935760.8686184347991238No Hit
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA4828780.8497915874332043No Hit
TAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA3072270.5406726337342788No Hit
CAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA1495400.26316757852865813No Hit
ATGTACACGGAGTCGACCCGCAACGCCAAAAAAAA1028350.18097390623240978No Hit
GAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA903750.15904620776733636No Hit
CTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA728830.12826295724156875No Hit
GCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA727790.12807993311312832No Hit
ATGTACACGGAGTCGACCCGCAACGTGAAAAAAAA696010.12248713811136239No Hit
GCGTCGCTAAAAAAAAAAAAAAAAAAAAAAAAAAA609210.10721166277614272No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCGTTTT106100.035.22483430
ATGTACA2910750.027.5945321
TGTACAC3101100.025.6068782
GTACACG3227650.024.6038513
CGTCTTT60650.023.80453930
CGTTTTT41950.023.43207630
TACACGG3376400.022.9074954
TGTAACG67300.022.888612
ACACGGA3427750.021.9073585
GTAACGG70800.021.461173
TACACGA137300.021.3119724
CACGGAG3464150.021.297616
ACGGAGT3400100.021.2480457
TATGTAC71750.021.061671
CGGAGTC3374850.020.7471248
GGAGTCG3397800.019.889379
CACGAGT135500.019.7835456
ACACGAG142750.019.4529745
CGAGTCG137550.019.2766138
TAACGGA77550.019.197764