FastQCFastQC Report
Tue 28 Feb 2017
fastq1_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq1_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences142238000
Sequences flagged as poor quality0
Sequence length20-50
%GC49

[FAIL]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGTACACGGAGTCGACCCAACGCGA36478182.5645875223217427No Hit
ATGTACACGGAGTCGAGCTCAACCCGCAACGCGA23631831.6614287321250298No Hit
ACGGAGTCGAGCTCAACCCGCAACGCGA2442730.17173540122892617No Hit
ACGGAGTCGACCCAACGCGA2235510.15716686117633827No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TATGCCG503050.0341.4868244
CTCGTAT827050.0331.7733841
CGTATGC846150.0328.8064343
TCGTATG846400.0328.5344242
TCTCGTA832600.0321.1103540
GTATGCC948950.0293.331644
ATCTCGT889650.0291.6660539
TATCTCG665650.0281.5889338
CCGTCTT172700.0272.902444
TACGATC134450.0241.4376435
GACGTAT126300.0220.8401634
CGTATCT137500.0217.8792336
GCCGTCT220700.0213.9102243
ACGTATC134950.0211.807735
ATATCTC413200.0210.6451137
ACGATCT160650.0209.3661236
CGACGTA130900.0203.261333
TACGATA158250.0201.9804733
GCATATC229850.0198.5085435
CGATATC177000.0196.6483535