FastQCFastQC Report
Tue 13 Dec 2016
fastq1_norrna_nosnrna_notrna.fq

Summary

[OK]Basic Statistics

MeasureValue
Filenamefastq1_norrna_nosnrna_notrna.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences5820894
Sequences flagged as poor quality0
Sequence length42
%GC49

[OK]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
CTGTAGGCACCATCAATAGATCGGAAGAGCACACGTCTGAAC2515884.322153950922315Illumina Multiplexing PCR Primer 2.01 (100% over 25bp)
AGAATTAAACTCCGAATGCCATAACTGTAGGCACCATCAATA1107051.9018556256135226No Hit
AGCTTCCTCAAAGATGAGTATTCCTCTGTAGGCACCATCAAT466640.8016637994095065No Hit
TCTTGAGTTGTGATGCATAGTGACTGTAGGCACCATCAATAG428260.7357289103701253No Hit
ATGATTTCATGTTTCCAAGAAAAGCTTCTGTAGGCACCATCA274870.47221268760434393No Hit
TAATCAAACTCCGAATACCATTACTGTAGGCACCATCAATAG214910.3692044555355242No Hit
TAGAATTAAACTCCGAATGCCATAACTGTAGGCACCATCAAT198840.34159701241768015No Hit
TAGGCACAGCTGGGTAGCTAAGTACGGAAACTGTAGGCACCA190550.3273552138211072No Hit
TGTTAAGTGAGAAAGGTTGTGAGCTGTAGGCACCATCAATAG182970.31433315913328774No Hit
TTAATCAAACTCCGAATACCATTACTGTAGGCACCATCAATA180490.3100726451984867No Hit
CTGTAGGCACCATTAATAGATCGGAAGAGCACACGTCTGAAC179670.30866392688133476Illumina Multiplexing PCR Primer 2.01 (100% over 25bp)
TAATCAAACTCCGAATACCATTAACTGTAGGCACCATCAATA177300.3045923873549321No Hit
TTAATCAAACTCCGAATACCATTAACTGTAGGCACCATCAAT157270.2701818655347443No Hit
CACAATACCGAAGCTACGGGCACATCTGTAGGCACCATCAAT152920.26270878665716985No Hit
GCTTCCTCAAAGATGAGTATTCCTCTGTAGGCACCATCAATA151330.2599772474812288No Hit
CTGTAGGCACTATCAATAGATCGGAAGAGCACACGTCTGAAC149150.2562321182966053Illumina Multiplexing PCR Primer 2.01 (100% over 25bp)
ATCTTGAGTTGTGATGCATAGTGACTGTAGGCACCATCAATA149060.256077502871552No Hit
TTGTAGGCACCATCAATAGATCGGAAGAGCACACGTCTGAAC148230.2546516050627275Illumina Multiplexing PCR Primer 2.01 (100% over 25bp)
TATGATAGTAGAAGAAGTTGGAAAGCTTCTGTAGGCACCATC141130.24245416597519212No Hit
GGCACAGCTGGGTAGCTAAGTACGGAAACTGTAGGCACCATC139560.23975698578259627No Hit
AGGCACAGCTGGGTAGCTAAGTACGGAAACTGTAGGCACCAT137020.23539339489775968No Hit
AGTAATACATTCAGCTGACCAATACTAATATCTGTAGGCACC136870.23513570252267094No Hit
GGAGTGGACGTACCGCTGGTGTTCCAGTTCTGTAGGCACCAT128920.22147800664296585No Hit
CTGTAGGTACCATCAATAGATCGGAAGAGCACACGTCTGAAC126940.218076467291794Illumina Multiplexing PCR Primer 2.01 (100% over 25bp)
TTGAGCTGACCAATACTAATAAATCGCTGTAGGCACCATCAA126450.21723467219983733No Hit
ACGTGGGGATGGATCCTGTAGGCACCATCAATAGATCGGAAG125790.21610082574944675No Hit
CCGTCTCGCCTGTAGGCACCATCAATAGATCGGAAGAGCACA122200.20993338823898874No Hit
CGTTGAAGTGTGATGGGGAGTGAACCTGTAGGCACCATCAAT120270.20661774634617983No Hit
ACAATACCGAAGCTACGGGCACATCTGTAGGCACCATCAATA120120.20636005397109106No Hit
CTGTAGGCATCATCAATAGATCGGAAGAGCACACGTCTGAAC119480.20526056650404562Illumina Multiplexing PCR Primer 2.01 (100% over 25bp)
CTGTAGGCACCATCAATAGATTGGAAGAGCACACGTCTGAAC119430.20517466904568268Illumina Multiplexing PCR Primer 2.01 (96% over 25bp)
TGAGCTGACCAATACTAATAAATCGCTGTAGGCACCATCAAT117650.20211671952796254No Hit
ACAGCTGGGTAGCTAAGTACGGAAACTGTAGGCACCATCAAT114510.19672235914277086No Hit
AGCGGGAAGCTTCCTCAAAGATGAGTATTCCTCTGTAGGCAC112440.19316620436654575No Hit
ACGTGCGGATGGATCACCTCTGTAGGCACCATCAATAGATCG103240.17736107202776755No Hit
TGTAGGCACCATCAATAGATCGGAAGAGCACACGTCTGAACT102040.17529953302705736Illumina Multiplexing PCR Primer 2.01 (100% over 26bp)
TAGGCACAGCTGGGTAGCTAAGTACGGAACTGTAGGCACCAT98120.16856517229140403No Hit
GTCTAGGGGTATGATTCTCCTGTAGGCACCATCAATAGATCG97180.16695030007418105No Hit
TCACAATACCGAAGCTACGGGCACATCTGTAGGCACCATCAA96470.1657305561654275No Hit
AAGGCGAGCGAGAAAACCAATGTTAAGGCTGTAGGCACCATC96020.16495747904016117No Hit
TACATTCAGCTGACCAATACTAATATCTGTAGGCACCATCAA95400.1638923505564609No Hit
GGCACAGCTGGGTAGCTAAGTACGGAACTGTAGGCACCATCA94720.16272414512272512No Hit
TGGACGTACCGCTGGTGTTCCAGTTCTGTAGGCACCATCAAT92020.1580856823711272No Hit
ACGTGGGGATGGAACACCTGTAGGCACCATCAATAGATCGGA91830.15775927202934809No Hit
TGGAGTGGACGTACCGCTGGTGTTCCAGTTCTGTAGGCACCA91660.15746722067091412No Hit
CGGGAAGCTTCCTCAAAGATGAGTATTCCTCTGTAGGCACCA89720.15413439928643263No Hit
AAGCTTCCTCAAAGATGAGTATTCCTCTGTAGGCACCATCAA87470.150269013660101No Hit
ATGATAGTAGAAGAAGTTGGAAAGCTTCTGTAGGCACCATCA82720.14210875511562313No Hit
CGTGCGGATGGATCACCTCTGTAGGCACCATCAATAGATCGG81890.14068285730679858No Hit
GGCACAGCTGGGTAGCTAAGTACGGACTGTAGGCACCATCAA80590.13844952338936253No Hit
GGGAAGCTTCCTCAAAGATGAGTATTCCTCTGTAGGCACCAT78890.13552900980502308No Hit
AGAATTAAACTCCGAATGCCATACTGTAGGCACCATCAATAG78420.13472157369641158No Hit
ATGATTTCATGTTTCCAAGAAAAGCTTCCTGTAGGCACCATC77150.1325397782539933No Hit
GCTGGTCCGATGGTAGTGGGTTATCAGAACTGTAGGCACCAT74600.1281590078774841No Hit
AGGCACAGCTGGGTAGCTAAGTACGGAACTGTAGGCACCATC73350.126011571418411No Hit
GAGTGGACGTACCGCTGGTGTTCCAGTTCTGTAGGCACCATC70530.12116695476674201No Hit
ATCTTGAGTTGTGATGCATAGTGCTGTAGGCACCATCAATAG67230.11549772251478896No Hit
TGGTCCGATGGTAGTGGGTTATCAGAACTGTAGGCACCATCA66250.11381413233087563No Hit
CGGAGTGGACGTACCGCTGGTGTTCCAGTTCTGTAGGCACCA65350.11226797808034299No Hit
ACGTGCGGATGGATCACCCTGTAGGCACCATCAATAGATCGG65170.11195874723023645No Hit
TAGGAAGATAGGAAGTTGCTTTCTGTAGGCACCATCAATAGA65170.11195874723023645No Hit
ACAACAGGTTAATATTCCTGTACTTGGTACTGTAGGCACCAT63420.1089523361875341No Hit
TTAAGCTAACCATTACTAATAGATCGCTGTAGGCACCATCAA62710.10773259227878054No Hit
AACTGTAGGCACCATCAATAGATCGGAAGAGCACACGTCTGA61100.10496669411949437Illumina Multiplexing PCR Primer 2.01 (100% over 23bp)
ACGTGCGGATGGATCCTGTAGGCACCATCAATAGATCGGAAG60720.10431387343593614No Hit
GCGGGAAGCTTCCTCAAAGATGAGTATTCCTCTGTAGGCACC60080.1032143859688907No Hit
GTATAGTGGTGAGTATCCCCCTGTAGGCACCATCAATAGATC59500.10221797545188077No Hit

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ACGTGCG35950.034.587181
TTAATCA45150.034.274941
GGGATGG51500.031.2244436
ATAATAC8400.031.0616651
TCGTGCG6650.030.8474481
TCGTTGA4850.030.7944431
GTCTAGG19850.030.7308941
TAGGGGT19850.030.684174
TCTGAAC425150.030.6326536
GTAATAC23300.030.4595742
TCACAAT17200.030.4439181
GTTTCCG6300.030.2761961
GTTAAGT32550.030.1938822
AGGGGTA20250.030.167055
CGTGGGG54250.030.1055642
TAGCCTC8250.030.099631
TCTAGGG20450.030.0479892
ATGTACA15000.029.9905741
TTAAGTG33000.029.7816353
TCCTCGG12150.029.768421