FastQCFastQC Report
Tue 28 Aug 2018
chx_cutadapt.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamechx_cutadapt.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences56354218
Sequences flagged as poor quality0
Sequence length25-51
%GC54

[FAIL]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AGTCCGCCCGGAGGATTCAACCCGGCGGCGGG8549281.5170612428691672No Hit
TCGACTGCATAATTTGTGGTAGTGGGGG8480361.504831457336521No Hit
TCGACTGCATAATTTGTGGTAGTGGGG7668801.3608209415664325No Hit
GTGGGGGGGCCGGGCCACCCCTCCCACGGCGC6190171.0984395169852237No Hit
TCGACTGCATAATTTGTGGTAGTGGGGGA5163280.9162189066309109No Hit
CCGCCGAGGGCGCACCACCGGCCCGTCTCGC4602230.8166611414960988No Hit
CGACTGCATAATTTGTGGTAGTGGGGG2836900.5034050867319284No Hit
CGACTGCATAATTTGTGGTAGTGGGG2283460.4051977085370966No Hit
CTCGACTGCATAATTTGTGGTAGTGGGGG2234270.39646899190403107No Hit
GACTGCATAATTTGTGGTAGTGGGGG1943540.34487924222460153No Hit
CGACTGCATAATTTGTGGTAGTGGGGGA1562280.2772250339805975No Hit
CCGCCGAGGGCGCACCACCGGCCCGTCTCG1512360.2683667795727376No Hit
TCGACTGCATAATTTGTGGTAGTTGGGG1316990.23369856715960463No Hit
CTCGCTTCTGGCGCCAAGCGCCCGGCCG1276460.22650655892341548No Hit
GACTGCATAATTTGTGGTAGTGGGGGA1109000.19679094828358723No Hit
CTCGACTGCATAATTTGTGGTAGTGGGG981320.17413425912502237No Hit
TGGGGGGGCCGGGCCACCCCTCCCACGGCGC917030.16272606249278448No Hit
GACCTGGTATTGCAGTACCTCCAGG871650.15467342657474192No Hit
GTGGGGGGGCCGGGCCACCCCTCCCACGGCG841850.14938544617902424No Hit
ACTGCATAATTTGTGGTAGTGGGGG840890.14921509513271927No Hit
GACTGCATAATTTGTGGTAGTGGGG823720.14616829568995174No Hit
CAGTCCGCCCGGAGGATTCAACCCGGCGGCGGG813390.14433524745210732No Hit
GTCCGCCCGGAGGATTCAACCCGGCGGCGGG803210.14252881656524805No Hit
CTCCCGGGGCTACGCCTGTCTGAGCGTCGCT745690.13232194970747355No Hit
CGCCGAGGGCGCACCACCGGCCCGTCTCGC711150.12619286102062494No Hit
TGCGCCGCGACCGGCTCCGGGACGGCTGGG700730.12434384237218943No Hit
TCGACTGCATAATTTGTGGTAGTTGGG693710.12309815034608412No Hit
CACTCGCCGAATCCCGGGGCCGAGGGAGCG680910.12082680306201747No Hit
ACTGCATAATTTGTGGTAGTGGGGGA673540.11951900388361347No Hit
TTTTCACTGACCCGGTGAGGCGGGG621770.11033246881360327No Hit
GTGCGCCGCGACCGGCTCCGGGACGGCTGGG603350.10706385811262611No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCGCGAC287100.0445.3032529
ACGCGTC18000.0402.9466644
CACGCGT19650.0392.2895242
CGTAAGA35750.0372.1335432
GTAAGAG40200.0341.5480733
GCACACT45800.0313.197739
TCGTAAG37150.0311.4875531
ACGTCTG152100.0307.355345
CACACTT53600.0302.0789540
CGCGTCT24350.0297.7894645
GGCGCGA334400.0297.4214228
GCGCACA37250.0270.9035639
CGCACAC31650.0268.9738240
CCCCGTT40000.0264.7886439
CACGTCT165850.0263.4241344
CGTCTGA165000.0261.1611644
CCCCCTT48300.0260.976237
ACACGTC136350.0260.5905543
CGTCTAA18750.0259.3360645
TATCGTA26850.0243.7113529